
Rice Science ›› 2023, Vol. 30 ›› Issue (5): 473-485.DOI: 10.1016/j.rsci.2023.04.003
收稿日期:2022-12-06
接受日期:2023-04-23
出版日期:2023-09-28
发布日期:2023-08-14
. [J]. Rice Science, 2023, 30(5): 473-485.
Fig. 1. Effects of different concentrations of water extract of rice false smut balls (RBWE) on cell proliferation in BNL CL.2 cells. A, Cell viability was measured by Cell Counting Kit-8 (CCK8) assay. Data are Mean ± SE (n = 3). B, Cell morphology changes at 24?h after RBWE treatment. Scale bars, 100 μm. The red arrows indicate vascular degeneration in cells. C, Morphological changes in BNL CL.2 cells were observed under a scanning electron microscope. Scale bars, 10 μm.
Fig. 2. BNL CL.2 cell apoptosis was investigated by cell cycle assay and mitochondrial membrane potential assay. A, Histogram of cell cycle. G2, DNA late synthesis phase; S, DNA synthesis phase; G0/G1, DNA presynthesis phase. B, Histogram of cell apoptosis at 24?h after water extract of rice false smut balls (RBWE) treatment. Data are Mean ± SE (n = 3). **, P < 0.01.
Fig. 3. Effects of water extract of rice false smut balls (RBWE) on reactive oxygen species (ROS) content in BNL CL.2 cells. Data are Mean ± SE (n = 3). *, P < 0.05; **, P < 0.01.
Fig. 4. Water extract of rice false smut balls (RBWE)-induced changes in livers of mice. A, Body weight curve. B, Liver weight. C, Liver weight to body weight ratio. D, Histopathological examination of liver by haematoxylin-eosin staining. Typical sections of the hepatic central venous region in mice. Scale bars, 10 μm. E, Alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP) levels. F, Total bile acid (TBA) concentration. *, P ?<? 0.05; **, P? <? 0.01. Values are Mean ± SE (n ?= ?12).
Fig. 5. Water extract of rice false smut balls (RBWE)-induced changes in oxidative stress indices in mouse livers. ROS, Reactive oxygen species; MDA, Malondialdehyde; SOD, Superoxide dismutase; CAT, Catalase; GSH, Glutathione; GSSG, Oxidized glutathione; GSH-Px, Reduced glutathione. *, P ?<? 0.05; **, P? <? 0.01. Values are Mean ± SE (n ?= ?8).
Fig. 6. Water extract of rice false smut balls (RBWE) affected oxidative stress-related proteins and genes. A and B, Nrf2 and Haem oxygenase-1 (HO-1) protein levels in BNL CL.2 cells. C, Nrf2 mRNA expression in BNL CL.2 cells. D, HO-1 mRNA expression in BNL CL.2 cells. E and F, Nrf2 and HO-1 protein levels in mouse livers. G, Nrf2 mRNA expression in mouse livers. H, HO-1 mRNA expression in mouse livers. I-L, Nuclear Nrf2 protein level. I and J, Nuclear Nrf2 protein level in BNL CL.2 cells. K and L, Nuclear Nrf2 protein level in mouse livers. *, P ?<? 0.05; **, P? <? 0.01. Values are Mean ± SE (n ?= ?3).
Fig. 7. Expression of apoptosis- and pathway-related proteins and genes in BNL CL.2 cells. A, Expression levels of apoptotic factors in BNL CL.2 cells assessed by Western blot analysis. B, Content of Bcl-2. C, Content of Bax. D, Bcl-2/Bax relative intensity. E, Content of Caspase 3. F, Content of cleaved Caspase 3. G, Content of poly ADP-ribose polymerase (PARP). H, Content of Caspase 9. I, Content of cleaved Caspase 9. J-L, mRNA expression levels of Bcl-2 (J), Bax (K) and Bcl-2/Bax (L) genes by qRT-PCR. *, P ?<? 0.05; **, P? <? 0.01. Values are Mean ± SE (n ?= ?3).
| Target gene | Marker | Primer sequence (5'-3') |
|---|---|---|
| Bcl2 | Bcl2-F | TGGAGAGCGTCAACAGGGAG |
| Bcl2-R | CAGCCAGGAGAAATCAAACAGA | |
| Bax | Bax-F | ACAGATCATGAAGACAGGGGG |
| Bax-R | CAAAGTAGAAGAGGGCAACCAC | |
| Nrf2 | Nrf2-F | TAGATGACCATGAGTCGCTTGC |
| Nrf2-R | GCCAAACTTGCTCCATGTCC | |
| HO-1 | HO-1-F | GATAGAGCGCAACAAGCAGAA |
| HO-1-R | CAGTGAGGCCCATACCAGAAG | |
| GAPDH | GAPDH-F | AGGTCGGTGTGAACGGATTTG |
| GAPDH-R | TGTAGACCATGTAGTTGAGGTCA |
Table 1. Specific sequences of PCR primers.
| Target gene | Marker | Primer sequence (5'-3') |
|---|---|---|
| Bcl2 | Bcl2-F | TGGAGAGCGTCAACAGGGAG |
| Bcl2-R | CAGCCAGGAGAAATCAAACAGA | |
| Bax | Bax-F | ACAGATCATGAAGACAGGGGG |
| Bax-R | CAAAGTAGAAGAGGGCAACCAC | |
| Nrf2 | Nrf2-F | TAGATGACCATGAGTCGCTTGC |
| Nrf2-R | GCCAAACTTGCTCCATGTCC | |
| HO-1 | HO-1-F | GATAGAGCGCAACAAGCAGAA |
| HO-1-R | CAGTGAGGCCCATACCAGAAG | |
| GAPDH | GAPDH-F | AGGTCGGTGTGAACGGATTTG |
| GAPDH-R | TGTAGACCATGTAGTTGAGGTCA |
| [1] | Andargie M, Li L Y, Feng A Q, Zhu X Y, Li J X. 2018. Mapping of the quantitative trait locus (QTL) conferring resistance to rice false smut disease. Curr Plant Biol, 15: 38-43. |
| [2] | Basu A, Singha Roy S, Bhattacharjee A, Bhuniya A, Baral R, Biswas J, Bhattacharya S. 2016. Vanadium(III)-l-cysteine protects cisplatin-induced nephropathy through activation of Nrf2/HO-1 pathway. Free Radic Res, 50(1): 39-55. |
| [3] | Bhattacharjee P, Borah A, Das S. 2020. Quercetin-induced amelioration of deltamethrin stress in freshwater teleost, Channa punctata: Multiple biomarker analysis. Comp Biochem Physiol C: Toxicol Pharmacol, 227: 108626. |
| [4] | Cao Z Y, Sun L H, Mou R X, Lin X Y, Zhou R, Ma Y N, Chen M X. 2016. Analysis of ustiloxins in rice using polymer cation exchange cleanup followed by liquid chromatography-tandem mass spectrometry. J Chromatogr A, 1476: 46-52. |
| [5] |
Chen Y G, Liu K L, Shi Y F, Shao C S. 2018. The tango of ROS and p53 in tissue stem cells. Cell Death Differ, 25(4): 639-641.
PMID |
| [6] |
Chen Y Y, He L Y, Yang Y Y, Chen Y, Song Y R, Lu X, Liang Y M. 2019. The inhibition of Nrf2 accelerates renal lipid deposition through suppressing the ACSL1 expression in obesity-related nephropathy. Ren Fail, 41(1): 821-831.
PMID |
| [7] | Cheng S Y, Liu H, Sun Q, Kong R, Letcher R J, Liu C S. 2019. Occurrence of the fungus mycotoxin, ustiloxin A, in surface waters of paddy fields in Enshi, Hubei, China, and toxicity in Tetrahymena thermophila. Environ Pollut, 251: 901-909. |
| [8] |
Choudhari S K, Chaudhary M, Gadbail A R, Sharma A, Tekade S. 2014. Oxidative and antioxidative mechanisms in oral cancer and precancer: A review. Oral Oncol, 50(1): 10-18.
PMID |
| [9] |
Chowdhury F I, Yasmin T, Akter R, Islam M N, Hossain M M, Khan F, Aldhahrani A, Soliman M M, Subhan N, Haque M A, Alam M A. 2022. Resveratrol treatment modulates several antioxidant and anti-inflammatory genes expression and ameliorated oxidative stress mediated fibrosis in the kidneys of high-fat diet-fed rats. Saudi Pharm J, 30(10): 1454-1463.
PMID |
| [10] | Cohen G M. 1997. Caspases: The executioners of apoptosis. Biochem J, 326: 1-16. |
| [11] |
D’Arcy M S. 2019. Cell death: A review of the major forms of apoptosis, necrosis and autophagy. Cell Biol Int, 43(6): 582-592.
PMID |
| [12] |
Elmore S. 2007. Apoptosis: A review of programmed cell death. Toxicol Pathol, 35(4): 495-516.
PMID |
| [13] | Fan R, Sui J D, Dong X P, Jing B, Gao Z Z. 2021. Wedelolactone alleviates acute pancreatitis and associated lung injury via GPX4 mediated suppression of pyroptosis and ferroptosis. Free Radic Biol Med, 173: 29-40. |
| [14] | Fu X X, Wang W X, Li Y Y, Wang X H, Tan G Y, Lai D W, Wang M A, Zhou L G, Wang B M. 2018. Development of a monoclonal antibody with equal reactivity to ustiloxins A and B for quantification of main cyclopeptide mycotoxins in rice samples. Food Control, 92: 201-207. |
| [15] | Gur C, Kandemir F M, Caglayan C, Satici E. 2022. Chemopreventive effects of hesperidin against paclitaxel-induced hepatotoxicity and nephrotoxicity via amendment of Nrf2/HO-1 and caspase-3/ Bax/Bcl-2 signaling pathways. Chem Biol Interact, 365: 110073. |
| [16] | Hirao H, Dery K J, Kageyama S, Nakamura K, Kupiec-Weglinski J W. 2020. Heme Oxygenase-1 in liver transplant ischemia- reperfusion injury: From bench-to-bedside. Free Radic Biol Med, 157: 75-82. |
| [17] | Hu Z, Dang Y, Liu C S, Zhou L G, Liu H. 2019. Acute exposure to ustiloxin A affects growth and development of early life zebrafish. Danio rerio. Chemosphere, 226: 851-857. |
| [18] | Kim K W, Park E W. 2007. Ultrastructure of spined conidia and hyphae of the rice false smut fungus Ustilaginoidea virens. Micron, 38(6): 626-631. |
| [19] |
Li Y, Koiso Y, Kobayashi H, Hashimoto Y, Iwasaki S. 1995. Ustiloxins, new antimitotic cyclic peptides: Interaction with porcine brain tubulin. Biochem Pharmacol, 49(10): 1367-1372.
PMID |
| [20] | Liu L L, Yan X, Xue K Y, Wang X M, Li L Y, Chen H Y, Li R L, Li H, Lan J, Xin J J, Li X, Zhuo C L, Wu Z, Zhang D, Huang W J, Wang Y L, Li X Y, Jiang W, Zhang H Y. 2022. Prim-O- glucosycimifugin attenuates liver injury in septic mice by inhibiting NLRP3 inflammasome/caspase-1 signaling cascades in macrophages. Phytomedicine, 106: 154427. |
| [21] |
Liu X S, Zou H, Slaughter C, Wang X D. 1997. DFF, a heterodimeric protein that functions downstream of Caspase-3 to trigger DNA fragmentation during apoptosis. Cell, 89(2): 175-184.
PMID |
| [22] |
Ludueńa R F, Roach M C, Prasad V, Banerjee M, Koiso Y, Li Y, Iwasaki S. 1994. Interaction of ustiloxin A with bovine brain tubulin. Biochem Pharmacol, 47(9): 1593-1599.
PMID |
| [23] |
Majtnerová P, Roušar T. 2018. An overview of apoptosis assays detecting DNA fragmentation. Mol Biol Rep, 45: 1469-1478.
PMID |
| [24] |
Miyazaki S, Matsumoto Y, Uchihara T, Morimoto K. 2009. High- performance liquid chromatographic determination of ustiloxin A in forage rice silage. J Vet Med Sci, 71(2): 239-241.
PMID |
| [25] |
Muhammad I, Wang X H, Li S H, Li R, Zhang X Y. 2018. Curcumin confers hepatoprotection against AFB1-induced toxicity via activating autophagy and ameliorating inflammation involving Nrf2/HO-1 signaling pathway. Mol Biol Rep, 45(6): 1775-1785.
PMID |
| [26] | Nakamura K, Izumiyama N, Ohtsubo K, Koiso Y, Iwasaki S. 1993. Apoptosis induced in the liver, kidney and urinary bladder of mice by the fungal toxin produced by Ustilaginoidea virens Mycotoxins, 38: 25-30. |
| [27] |
Nakamura K I, Izumiyama N, Ohtsubo K I, Koiso Y, Iwasaki S, Sonoda R, Fujita Y, Yaegashi H, Sato Z. 1994. “Lupinosis”-like lesions in mice caused by ustiloxin, produced by Ustilaginoieda virens: A morphological study. Nat Toxins, 2(1): 22-28.
PMID |
| [28] | Peng Y Y, Bishop K S, Ferguson L R, Quek S Y. 2022. Phenolic- rich feijoa extracts from flesh, peel and whole fruit activate apoptosis pathways in the LNCaP cell line. Food Chem, 383: 132285. |
| [29] | Qiu J H, Meng S, Deng Y Z, Huang S W, Kou Y J. 2019. Ustilaginoidea virens: A fungus infects rice flower and threats world rice production. Rice Sci, 26(4): 199-206. |
| [30] |
Ramachandran A, Visschers R G J, Duan L Q, Akakpo J Y, Jaeschke H. 2018. Mitochondrial dysfunction as a mechanism of drug-induced hepatotoxicity: Current understanding and future perspectives. J Clin Transl Res, 4(1): 75-100.
PMID |
| [31] | Sun Q, Liu H, Zhang Y K, Kong R, Yi X E, Liu C S. 2021. Detection of ustiloxin A in urine by ultra-high-performance liquid chromatography-tandem mass spectrometry coupled with two-step solid-phase extraction. J Chromatogr B, 1181: 122916. |
| [32] | Sun Q, Liu H, Zhang Y K, Yi X E, Kong R, Cheng S Y, Man J G, Zheng L, Huang J B, Su G Y, Letcher R J, Giesy J P, Liu C S. 2022. Global distribution of ustiloxins in rice and their male-biased hepatotoxicity. Environ Pollut, 301: 118992. |
| [33] |
Tanaka H, Sawayama A M, Wandless T J. 2003. Enantioselective total synthesis of ustiloxin D. J Am Chem Soc, 125(23): 6864-6865.
PMID |
| [34] | Wang X H, Wang J, Lai D W, Wang W X, Dai J G, Zhou L G, Liu Y. 2017. Ustiloxin G, a new cyclopeptide mycotoxin from rice false smut balls. Toxins, 9(2): 54. |
| [35] | Wang Y Q, Li G B, Gong Z Y, Li Y, Huang F, Fan J, Wang W M. 2016. Stachyose is a preferential carbon source utilized by the rice false smut pathogen. Villosiclava virens. Physiol Mol Plant Pathol, 96: 69-76. |
| [36] | Wu N, Jiang H B, Bao Y D, Zhang C, Zhang J Z, Song W J, Zhao Y Y, Mi C X, He Y, Liu F. 2020. Practicability investigation of using near-infrared hyperspectral imaging to detect rice kernels infected with rice false smut in different conditions. Sens Actuat B Chem, 308: 127696. |
| [37] | Xiong M, Meng S, Qiu J H, Shi H B, Shen X L, Kou Y J. 2020. Putative phosphatase UvPsr1 is required for mycelial growth, conidiation, stress response and pathogenicity in Ustilaginonidea virens Rice Sci, 27(6): 529-536. |
| [38] |
Yang Q Y, Han B, Li S Y, Wang X Q, Wu P F, Liu Y, Li J Y, Han B Q, Deng N, Zhang Z G. 2022. The link between deacetylation and hepatotoxicity induced by exposure to hexavalent chromium. J Adv Res, 35: 129-140.
PMID |
| [39] | Yang X, Fang Y, Hou J B, Wang X J, Li J Y, Li S Y, Zheng X Y, Liu Y, Zhang Z G. 2022. The heart as a target for deltamethrin toxicity: Inhibition of Nrf2/HO-1 pathway induces oxidative stress and results in inflammation and apoptosis. Chemosphere, 300: 134479. |
| [40] | Yu J J, Yu M N, Song T Q, Cao H J, Yong M L, Pan X Y, Qi Z Q, Du Y, Zhang R S, Yin X L, Liang D, Liu Y F. 2021. UvSMEK1, a suppressor of MEK null, regulates pathogenicity, conidiation and conidial germination in rice false smut fungus Ustilaginoidea virens. Rice Sci, 28(5): 457-465. |
| [41] |
Zhang Q, Wang L P, Chen G L, Wang M X, Hu T Z. 2021. Cylindrospermopsin impairs vascular smooth muscle cells by P53-mediated apoptosis due to ROS overproduction. Toxicol Lett, 353: 83-92.
PMID |
| [42] | Zhang X X, Li M, Wu H, Fan W Y, Zhang J S, Su W W, Wang Y G, Li P B. 2022. Naringenin attenuates inflammation, apoptosis, and ferroptosis in silver nanoparticle-induced lung injury through a mechanism associated with Nrf2/HO-1 axis: In vitro and in vivo studies. Life Sci, 311: 121127. |
| [43] | Zou J, Wang S P, Wang Y T, Wan J B. 2021. Regulation of the NLRP3 inflammasome with natural products against chemical- induced liver injury. Pharmacol Res, 164: 105388. |
| No related articles found! |
| 阅读次数 | ||||||
|
全文 |
|
|||||
|
摘要 |
|
|||||