Rice Science
  • 首页
  • 期刊介绍
  • 编委会
  • 学术伦理
  • 投稿指南
  • 期刊订阅
  • 联系我们
  • English

Rice Science ›› 2020, Vol. 27 ›› Issue (2): 124-132.DOI: 10.1016/j.rsci.2020.01.003

• • 上一篇    下一篇

  • 收稿日期:2018-09-25 接受日期:2018-12-22 出版日期:2020-03-28 发布日期:2019-11-28

RichHTML

PDF

可视化

0

摘要/Abstract

引用本文

. [J]. Rice Science, 2020, 27(2): 124-132.

使用本文

0
    /   推荐

导出引用管理器 EndNote|Ris|BibTeX

链接本文: http://www.ricesci.org/CN/10.1016/j.rsci.2020.01.003

               http://www.ricesci.org/CN/Y2020/V27/I2/124

图/表 9

Supplemental Table 1. Leaf rolling, leaf drying, spikelet fertility and single plant yield of 348 early and mid-early duration germplasm lines under moderate drought stress.
No. Accession Origin/place of adaption Leaf rolling Leaf drying Spikelet fertility (%) Single plant yield (g)
1 ARC12071 Assam, India 3 (89.25) 3 (84.25) 63.0218 10.55
2 Ac 10984 India 1 (94.25) 1 (89.25) 81.8218 11.57
3 Ac 39800 India 3 (94.25) 3 (89.25) 63.8218 10.15
4 NSIC Rc 106 IRRI, Philippines 7 (84.25) 7 (79.25) 15.8818 4.255
5 Ac 39739 India 3 (89.25) 3 (85.25) 65.1218 9.245
6 HONGZUI EL IRRI, Philippines 7 (89.25) 5 (84.25) 28.271875 6.235
7 Ac 39804 India 3 (94.25) 3 (89.25) 61.321875 10.335
8 Ac 10914 India 1 (95.25) 1 (89.25) 83.121875 12.305
9 Ac 39770 India 3 (92.25) 3 (89.25) 61.821875 9.835
10 BENAMURI Odisha, India 5 (79.25) 3 (79.25) 43.071875 7.525
11 Ac 39737 India 3 (84.25) 3 (84.25) 65.121875 10.345
12 Ac 39955 India 3 (94.25) 3 (89.25) 62.021875 9.935
13 Ac 39843 India 1 (97.25) 1 (94.25) 74.321875 12.355
14 SATHI Utter Pradesh, India 5 (74.25) 3 (79.25) 46.221875 8.355
15 Ac 39769 India 3 (84.25) 3 (87.25) 45.321875 9.555
16 Ac 39933 India 3 (87.25) 3 (89.25) 49.921875 10.975
17 Ac 39794 India 3 (89.25) 3 (91.25) 48.921875 10.535
18 DZ78 IRRI, Philippines 5 (79.25) 5 (84.25) 33.121875 6.775
19 Ac39827 India 5 (74.25) 5 (79.25) 42.721875 6.615
20 Ac 39928 India 5 (84.25) 5 (79.25) 30.121875 5.475
21 Ac 39823 India 5 (89.25) 5 (84.25) 29.221875 5.675
22 SUDUWEE IRRI, Philippines 5 (89.25) 3 (74.25) 41.871875 7.245
23 Ac 39871 India 3 (94.25) 3 (91.25) 49.321875 10.355
24 Ac 39781 India 3 (97.25) 3 (94.25) 61.921875 9.565
25 Ac 39773 India 3 (91.25) 3 (89.25) 49.521875 9.585
26 KHAODAW Thailand 5 (89.25) 3 (87.25) 38.121875 7.115
27 Ac 39795 India 3 (91.25) 3 (89.25) 61.321875 8.975
28 Ac 39776 India 5 (89.25) 5 (84.25) 33.921875 6.375
29 EZI China 5 (95.25) 5 (91.25) 33.121875 5.255
30 Ac 39910 India 5 (91.25) 5 (89.25) 38.421875 6.645
31 Ac 10931 India 3 (94.25) 3 (91.25) 58.821875 9.645
32 MADHABSA Bangadesh 5 (84.25) 5 (79.25) 33.741875 6.225
33 Ac 39749 India 3 (94.25) 3 (91.25) 65.321875 10.355
34 Ac 39792 India 7 (97.25) 7 (96.25) 6.121875 4.205
35 ARC 10319 Assam, India 5 (89.25) 3 (89.25) 36.021875 7.845
36 Ac 10981 India 5 (91.25) 5 (89.25) 19.921875 5.975
37 Ac 39755 India 5 (84.25) 5 (79.25) 20.121875 6.475
38 Ac 39733 India 3 (89.25) 3 (87.25) 61.421875 10.575
39 Ac 39760 India 3 (91.25) 3 (89.25) 46.621875 10.115
40 Ac 10939 India 3 (93.25) 3 (89.25) 63.321875 10.535
41 ARC10818 Assam, India 7 (94.25) 7 (91.25) 21.841875 4.515
42 Ac 11206 India 7 (95.25) 5 (87.25) 6.421875 5.575
43 Ac 39834 India 5 (74.25) 5 (79.25) 20.021875 6.645
44 AL LANKE - 5 (80) 5 (81.5) 30.821875 5.07
45 Ac 10816 India 3 (78) 3 (79.5) 61.721875 9.97
46 Ac 11209 India 7 (85) 5 (79.5) 6.921875 4.87
47 HARBHOOND Madhya Pradesh, India 3 (85) 3 (86.5) 40.921875 8.95
48 Ac 10820 India 3 (90) 3 (91.5) 63.221875 9.07
49 Ac 11261 India 1 (98) 1 (94.5) 81.921875 12.54
50 HAWSHAO IRRI, Philippines 5 (75) 5 (77.5) 23.921875 5.52
51 Ac 10995 India 3 (80) 3 (81.5) 47.321875 9.63
52 Ac 10914 India 7 (98) 7 (94.5) 17.221875 5.05
53 RAY JAZAYKAYZ IRRI, Philippines 3 (88) 3 (84.5) 47.521875 8.51
54 Ac 10837 India 5 (70) 3 (64.5) 38.621875 6.64
55 Ac 11087 India 7 (95) 7 (94.5) 7.521875 4.62
56 AUS 439 Assam, India 5 (82) 5 (79.5) 29.921875 5.87
57 Ac 10843 India 5 (65) 3 (69.5) 40.821875 5.51
58 Ac 10840 India 5 (75) 3 (69.5) 42.121875 5.71
59 Ac 11074 India 7 (95) 7 (91.5) 19.221875 4.95
60 RR 272-17- Jharkhand, India 5 (92) 5 (89.5) 27.921875 5.28
61 Ac 10990 India 5 (85) 5 (81.5) 37.321875 7.24
62 Ac 11462 India 3 (85) 3 (84.5) 58.321875 7.05
63 RAB-56-50 Africa 5 (90) 3 (87.5) 31.921875 6.74
64 Ac 10956 India 5 (92) 5 (89.5) 39.821875 5.02
65 Ac 10811 India 7 (75) 5 (71.5) 16.821875 6.04
66 Ac 10875 India 5 (78) 3 (74.5) 40.921875 5.97
67 Heera Odisha, India 5 (72) 3 (77.5) 40.521875 7.08
68 Ac 11069 India 1 (95) 3 (84.5) 67.421875 9.07
69 Ac 10965 India 3 (90) 3 (87.5) 63.721875 8.08
70 Ac 10857 India 3 (92) 3 (89.5) 46.521875 9.27
71 DASARAMATIA India 5 (78) 3 (74.5) 41.521875 7.28
72 Ac 39911 India 5 (80) 3 (74.5) 33.821875 6.94
73 Ac 39750 India 7 (80) 5 (77.5) 16.821875 6.04
74 Ac 39957 India 3 (85) 3 (84.5) 63.121875 8.74
75 JALIA India 5 (78) 3 (74.5) 35.821875 7.49
76 Ac 10862 India 5 (68) 3 (69.5) 42.521875 6.37
77 Ac 10915 India 3 (85) 3 (84.5) 36.121875 8.75
78 Ac 39870 India 3 (88) 3 (84.5) 37.121875 8.54
79 HASURIDHAN India 5 (90) 5 (84.5) 30.921875 5.93
80 Ac 10994 India 7 (95) 5 (79.5) 17.521875 5.72
81 Ac 10984 India 3 (93) 3 (89.5) 45.621875 9.61
82 CR143-2-2 NRRI, Cuttack, India 1 (98) 1 (94.5) 70.621875 12.65
83 Ac 10954 India 7 (75) 5 (69.5) 18.021875 4.6
84 Ac 39840 India 3 (85) 3 (84.5) 58.321875 9.05
85 SADABAHAR Jharkhand, India 5 (80) 3 (74.5) 36.821875 6.99
86 Ac 10958 India 3 (90) 3 (87.5) 60.621875 9.6
87 Ac 10925 India 7 (92.25) 7 (92) 16.771875 4.775
88 RR347-1 Jharkhand, India 5 (82.25) 3 (80) 41.171875 7.315
89 Ac 10976 India 1 (96.25) 1 (94) 65.471875 12.765
90 Ac 11085 India 5 (85.25) 3 (80) 36.871875 6.465
91 Ac 10957 India 5 (85.25) 3 (85) 34.971875 5.665
92 LALANKANDA-41 India 1 (98.25) 1 (95) 69.471875 11.465
93 Ac 11433 India 3 (92.25) 3 (90) 61.271875 9.445
94 Ac 39975 India 3 (80.25) 1 (85) 64.671875 8.765
95 Ac 11280 India 3 (85.25) 3 (85) 61.771875 8.675
96 Ac 11217 India 3 (90.25) 3 (90) 63.171875 9.865
97 RR-2-6 Jharkhand, India 3 (85.25) 3 (90) 51.571875 10.775
98 Ac 11114 India 7 (85.25) 5 (80) 15.471875 5.665
99 Ac 11328 India 5 (80.25) 3 (78) 38.071875 6.795
100 JOGESH Jharkhand, India 3 (92.25) 3 (92) 45.571875 9.575
101 Ac 11030 India 3 (90.25) 3 (90) 43.071875 8.965
102 Ac 10925 India 1 (95.25) 1 (95) 65.871875 12.665
103 Dinorado Philippines 1 (96.25) 1 (96) 62.371875 13.415
104 Ac 11007 India 3 (90.25) 3 (92) 46.671875 9.435
105 Ac 39890 India 1 (98.25) 1 (95) 82.071875 11.735
106 Ac 11258 India 3 (65.25) 3 (70) 61.771875 9.335
107 RR-348-6 Jharkhand, India 5 (70.25) 3 (80) 39.771875 8.735
108 Ac 11265 India 3 (80.25) 3 (90) 55.071875 9.455
109 Ac 11205 India 3 (85.25) 3 (80) 46.471875 9.275
110 RR-665-645 Jharkhand, India 5 (75.25) 3 (70) 37.171875 8.625
111 Ac 11333 India 3 (70.25) 3 (75) 38.871875 8.665
112 Ac 11246 India 3 (88.25) 3 (85) 36.971875 8.765
113 VANAPRABHA Odisha, India 5 (78.25) 3 (75) 35.571875 7.665
114 Ac 11311 India 3 (90.25) 1 (88) 63.571875 9.535
115 Ac 11057 India 3 (95.25) 3 (90) 47.271875 8.775
116 RR20 Jharkhand, India 5 (90.25) 5 (90) 32.371875 5.845
117 Ac 11464 India 3 (85.25) 3 (80) 48.371875 8.965
118 RR160-10 Jharkhand, India 7 (98.25) 7 (98) 17.231875 4.445
119 RR 51-1 Jharkhand, India 3 (95.25) 3 (95) 52.271875 10.535
120 RR 347-466 Jharkhand, India 7 (98.25) 7 (98) 16.291875 4.735
121 Ac 39963 India 3 (92.25) 3 (92) 63.171875 8.195
122 KHANDAGIRI Odisha, India 3 (95.25) 3 (95) 54.271875 10.575
123 Ac 39753 India 7 (75.25) 5 (70) 19.871875 5.875
124 Ac 39839 India 3 (90.25) 3 (95) 48.871875 9.665
125 BLACKGORA Jharkhand, India 3 (80.25) 3 (90) 51.571875 11.575
126 Ac 39762 India 7 (75.25) 5 (80) 19.471875 4.865
127 RR354-1 Jharkhand, India 3 (90.25) 3 (88) 52.271875 11.565
128 RR 272-1745 Jharkhand, India 3 (92.25) 3 (90) 54.571875 11.575
129 Ac 39973 India 1 (96.25) 1 (95) 82.371875 12.855
130 Ac 10374 India 7 (83.5) 5 (79) 18.946875 5.7525
131 SATYABHAMA Odisha, India 3 (93.5) 3 (89) 63.146875 14.2625
132 Ac 39797 India 3 (86.5) 3 (84) 63.446875 9.5325
133 Ac 10978 India 7 (78.5) 3 (74) 18.146875 5.2025
134 PYARI Odisha, India 3 (93.5) 3 (74) 51.946875 11.5625
135 Ac 10964 India 3 (88.5) 3 (91) 56.246875 8.4225
136 Ac 10972 India 3 (93.5) 3 (89) 62.146875 10.0025
137 CR DHAN204 NRRI, Cuttack, India 5 (73.5) 3 (69) 46.546875 9.7325
138 Ac 10899 India 7 (93.5) 7 (94) 19.046875 3.8625
139 Ac 39759 India 7 (88.5) 5 (79) 19.546875 5.1225
140 Ac 39893 India 3 (93.5) 3 (94) 63.246875 8.5325
141 CR DHAN 202 NRRI, Cuttack, India 3 (90.5) 3 (89) 62.546875 13.1425
142 Ac 10972 India 5 (73.5) 3 (69) 28.846875 6.3325
143 Ac 11152 India 3 (78.5) 3 (84) 63.946875 9.7625
144 Ac 11322 India 3 (83.5) 1 (89) 63.146875 8.1325
145 CR DHAN 201 NRRI, Cuttack, India 5 (78.5) 3 (89) 52.946875 9.3625
146 Ac 10994 India 3 (83.5) 1 (79) 63.546875 7.8625
147 Ac 39790 India 1 (92.5) 1 (89) 81.346875 11.5625
148 Ac 10993 India 5 (82.5) 3 (81) 29.346875 5.4325
149 KALCHI India 5 (84.5) 5 (79) 23.446875 5.0925
150 Ac 11202 India 5 (88.5) 3 (84) 28.746875 4.5625
151 Ac 11208 India 5 (83.5) 3 (81) 26.646875 5.6625
152 Ac 10957 India 3 (90.5) 3 (89) 63.246875 9.2125
153 SETKA India 5 (63.5) 5 (74) 21.646875 5.0925
154 IR10C-137 IRRI, Philippines 3 (83.5) 1 (89) 64.546875 8.3325
155 IR10C-167 IRRI, Philippines 1 (83.5) 1 (79) 80.946875 10.2325
156 IR10C-136 IRRI, Philippines 3 (78.5) 1 (84) 65.246875 7.8625
157 CHINGERDHAN India 3 (88.5) 3 (89) 54.946875 9.3625
158 IR83142-B-36-B IRRI, Philippines 3 (83.5) 1 (79) 61.646875 8.5625
159 IR10C-108 IRRI, Philippines 3 (78.5) 1 (89) 63.546875 11.3325
160 BUNDEI India 3 (73.5) 3 (74) 52.446875 10.4425
161 IR10C-161 IRRI, Philippines 1 (93.5) 1 (89) 66.446875 13.4625
162 SHELLA India 5 (68.5) 3 (79) 36.746875 8.4425
163 CR Dhan 301 NRRI, Cuttack 7 (88.5) 7 (89) 17.946875 3.4425
164 IR10C-110 IRRI, Philippines 3 (83.5) 1 (89) 62.246875 10.7325
165 DHOBOSANKARI India 3 (80.5) 3 (81) 45.946875 9.6425
166 CR Dhan 303 NRRI, Cuttack, India 7 (92.5) 7 (93) 18.546875 3.5025
167 IR10C-179 IRRI, Philippines 3 (73.5) 1 (79) 63.046875 11.5325
168 CR Dhan 304 NRRI, Cuttack, India 7 (88.5) 7 (89) 18.466875 3.1325
169 IR10C-103 IRRI, Philippines 3 (73.5) 1(79) 64.746875 12.2325
170 KARNI India 1 (96.5) 1 (97) 63.146875 12.1825
171 CR Dhan 305 NRRI, Cuttack, India 5 (80.5) 5 (79) 27.546875 6.4625
172 IR10C-126 IRRI, Philippines 3 (83.5) 1 (79) 62.446875 10.5325
173 DENGBOREI Eastern India 3 (80.25) 3 (75) 52.046875 10.865
174 IR10G-103 IRRI, Philippines 1 (85.25) 1 (80) 65.846875 13.885
175 CR Dhan 306 NRRI, Cuttack, India 7 (90.25) 7 (90) 15.946875 3.215
176 SEKRE EasternIndia 7 (85.25) 7 (85) 18.146875 3.345
177 Maudamani NRRI, Cuttack, India 7 (98.25) 7 (98) 15.146875 3.585
178 CR Dhan 309 NRRI, Cuttack, India 7 (98.25) 7 (95) 17.746875 4.685
179 CR Dhan 205 NRRI, Cuttack, India 5 (85.25) 3 (75) 43.046875 8.925
180 TAWADHAN Northern India 5 (75.25) 3 ( 70) 40.246875 8.715
181 IR83141-B-32-B IRRI, Philippines 3 (85.25) 1 (80) 63.746875 13.625
182 IR64197-3B-15-2 IRRI, Philippines 3 (85.25) 1 (85) 63.946875 13.295
183 CR Dhan 206 NRRI, Cuttack, India 5 (92.25) 5 (90) 33.346875 7.985
184 KUTIARASI India 3 (95.25) 3 (92) 60.746875 12.915
185 CR Dhan 207 NRRI, Cuttack, India 5 (85.25) 3 (65) 38.146875 8.715
186 SEKRADHAN India 3 (85.25) 3 (85) 56.046875 10.715
187 IR10C-157 IRRI, Philippines 3 (90.25) 3 (88) 60.846875 5.745
188 GURUJIDHAN India 7 (80.25) 5 (80) 28.346875 9.925
189 Lalat Odisha, India 7 (85.25) 5 (85) 26.746875 5.745
190 KASALATH Bangladesh 3 (80.25) 3 (80) 60.446875 10.425
191 Satyakrishna Odisha, India 7 (90.25) 5 (80) 16.146875 4.745
192 Sahabhagi Dhan Odisha, india 1 (95.25) 1 (90) 65.846875 14.425
193 Satabdi West Bengal, India 7 (95.25) 7 (95) 18.346875 3.085
194 KUSUMA Odisha, India 3 (90.25) 3 (90) 46.146875 9.925
195 Annapurna Odisha, India 5 (80.25) 5 (80) 22.846875 5.425
196 Surendra Odisha, India 5 (85.25) 5 (82) 24.346875 4.945
197 BASARAMATIA India 5 (75.25) 3 (60) 35.246875 5.565
198 Birupa Odisha, India 5 (80.25) 5 (70) 27.946875 4.745
199 Naveen Odisha, India 5 (90.25) 5 (95) 23.846875 5.755
200 Bowdel India 1 (95.25) 1 (90) 68.046875 12.665
201 IR 72 IRRI, Phillippines 5 (75.25) 5 (75) 31.246875 4.285
202 LALSANKRI India 1 (90.25) 1 (90) 61.146875 11.365
203 CR2340-2 NRRI, Cuttack, India 1 (98.25) 1 (95) 81.546875 10.315
204 TEPIBORO Assam, India 1 (95.25) 1 (95) 44.246875 10.315
205 BORI India 3 (90.25) 3 (90) 50.846875 9.925
206 CR2340-1 NRRI, Cuttack, India 3 (75.25) 1 (70) 61.946875 11.625
207 Vijetha Andhra Pradesh, India 7 (70.25) 5 (75) 26.946875 5.325
208 SURJAMUKHI India 1 (95.25) 1 (95) 64.446875 12.955
209 Divya India 5 (80.25) 3 (85) 29.146875 4.645
210 Pusa 44 Uttar Pradesh, India 7 (85.25) 5 (80) 21.946875 3.275
211 FULLKATI India 3 (85.25) 3 (85) 55.746875 9.685
212 MENKASALA India 3 (90.25) 3 (90) 48.146875 10.385
213 ADT 43 Tamil Nadu, India 7 (75.25) 5 (80) 23.046875 4.715
214 CR2463-25 NRRI, Cuttack 5 (80.25) 5 (90) 27.746875 5.315
215 Khitish West Bengal, India 5 (70.25) 5 (70) 23.346875 4.715
216 Shaktiman Odisha, India 5 (67) 5 (71) 27.321875 5.035
217 MURIDANRA India 3 (82) 3 (71) 49.121875 10.685
218 BAILAM Bangladesh 3 (82) 3 (83) 54.121875 11.465
219 Bhoi Odisha, india 7 (87) 5 (81) 23.021875 5.525
220 RAISARIA India 3 (72) 3 (76) 53.421875 11.565
221 Indira Odisha, India 5 (62) 5 (66) 24.721875 4.215
222 Ratna Odisha, India 5 (67) 5 (61) 23.121875 5.285
223 SERETY Korea 3 (87) 3 (81) 63.421875 12.565
224 Konark Odisha, India 5 (77) 5 (71) 24.321875 5.415
225 Prasad India 5 (67) 5 (61) 25.421875 6.415
226 DV123 IRRI, Philippines 3 (77) 3 (71) 54.521875 11.865
227 BORO 4005 NRRI, Cuttack, India 5 (87) 5 (81) 32.021875 5.045
228 CR3813-4-4-4-2-2 NRRI, Cuttack, India 1 (82) 1 (86) 72.321875 11.425
229 BG301 Sri Lanka 3 (77) 3 (71) 53.521875 11.765
230 Jajati Odisha, India 7 (92) 5 (71) 22.021875 4.345
231 Radhi Odisha, India 7 (82) 5 (71) 25.721875 5.375
232 MANDRIRA IRRI, Philippine 3 (87) 3 (81) 61.621875 10.705
233 Sravani Odisha, India 7 (92) 5 (71) 24.721875 5.485
234 Sasyasree Odisha, India 7 (87) 5 (71) 23.821875 5.315
235 Gajapati Odisha, India 7 (92) 7 (91) 20.321875 4.715
236 Bhavani Odisha, India 7 (82) 5 (66) 29.721875 4.385
237 CSR90 Haryana, India 5 (82) 5 (86) 24.321875 6.705
238 IR 50 IRRI, Philippines 7 (92) 7 (91) 20.721875 4.415
239 CR3820-4-5-5-3-1 NRRI, Cuttack, India 7 (82) 5 (76) 33.221875 5.485
240 Tapaswini Odisha, India 7 (87) 7 (81) 20.421875 4.315
241 YN1353-3 IRRI, Philippines 3 (87) 3 (81) 53.521875 10.525
242 Ananga Odisha, India 7 (87) 7 (81) 21.121875 5.415
243 Chandan Odisha, india 5 (87) 3 (81) 29.621875 6.415
244 HABIGONJ BORO6 Bangladesh 3 (67) 3 (56) 65.121875 12.465
245 CR3621-6-1-3-1-2 NRRI, Cuttack, india 3 (77) 3 (81) 49.321875 8.525
246 Satabdi West Bengal, Odisha 7 (100) 7 (99) 20.821875 4.485
247 BAMAWPYAN IRRI, Philippine 1 (92) 1 (91) 64.421875 11.765
248 Kshira Odisha, india 7 (87) 7 (81) 19.021875 5.305
249 CR 2461-9 NRRI, Cuttack, india 5 (92) 3 (71) 39.121875 7.415
250 IR 8 IRRI, Philippines 7 (92) 5 (76) 21.921875 5.015
251 Gouri Odisha, India 7 (97) 7 (93) 19.721875 4.745
252 Vikramarya India 5 (77) 5 (71) 24.021875 5.615
253 CR Dhan 208 NRRI, Cuttack, India 5 (77) 3 (66) 43.121875 8.815
254 Luit Assam, India 5 (87) 5 (91) 22.821875 4.855
255 CO 43 Tamil Nadu, India 7 (92) 7 (91) 16.821875 5.675
256 Kalyani 2 Odisha, India 7 (77) 5 (61) 28.621875 8.785
257 Kalakeri Jharkhand, India 3 (87) 3 (86) 67.721875 11.025
258 Browngora Jharkhand, India 3 (94) 3 (91) 54.221875 10.525
259 CR3825-2-1-2-2-4 NRRI, Cuttack, India 5 (74.5) 5 (81) 23.971875 5.3275
260 Sneha Odisha, India 7 (91.5) 7 (91) 17.571875 4.3875
261 Lalnakanda India 3 (84.5) 1 (81) 64.471875 10.7675
262 LAXMIKAJAL India 3 (84.5) 1 (86) 52.971875 9.6675
263 CR 143-2-2 NRRI, Cuttack, India 1 (94.5) 1 (96) 80.471875 12.3875
264 WAB 56-50 Africa 5 (69.5) 5 (76) 26.371875 7.4475
265 WITA 10 Africa 5 (64.5) 5 (61) 33.971875 7.3675
266 Govind Uttar Pradesh, India 7 (84.5) 5 (76) 27.371875 5.3575
267 KASARAKUNDA India 3 (74.5) 3 (66) 51.671875 10.7575
268 CR Dhan 601 Odisha, India 5 (69.5) 5 (76) 42.271875 7.6675
269 Rasi Andhra Pradesh, India 3 (79.5) 3 (76) 48.071875 9.4775
270 CR3825-2-1-2-2-3 NRRI, Cuttack, India 5 (74.5) 3 (71) 34.971875 6.4675
271 Jyothi Kerala, India 5 (74.5) 3 (66) 27.071875 4.6575
272 Nidhi Tamil Nadu, India 7 (84.5) 7 (81) 16.971875 3.3575
273 PUNEI India 3 (64.5) 3 (61) 41.671875 8.7975
274 CR3820-4-5-3-1-3 NRRI, Cuttack, India 7 (89.5) 7 (91) 41.371875 3.3575
275 ADT 45 Tamil Nadu, India 7 (84.5) 5 (76) 23.971875 5.6675
276 DUMERPHULLI India 3 (74.5) 3 (81) 53.771875 11.5075
277 Ratnagiri 3 Maharashtra, India 5 (79.5) 5 (86) 27.471875 6.4275
278 Mahamaya Chhattisgarh, India 7 (74.5) 5 (66) 21.671875 5.7875
279 LAHDIL India 3 (74.5) 3 (71) 48.171875 9.9775
280 Kushal India 5 (59.5) 5 (66) 25.071875 6.4975
281 CR3621-6-1-3-1-1 NRRI, Cuttack, India 5 (84.5) 3 (83) 34.071875 6.5575
282 HAZARIDHAN Jharkhand, India 3 (89.5) 3 (86) 42.171875 8.6675
283 CR3820-2-1-5-1-2 NRRI, Cuttack, India 5 (84.5) 5 (81) 25.271875 6.3475
284 KALINGA II Odisha, India 5 (74.5) 3 (71) 39.171875 8.2675
285 Bhadra India 5 (64.5) 5 (66) 28.771875 5.3475
286 CR3826-8-3-2-1-1 NRRI, Cuttack, India 5 (74.5) 5 (71) 28.571875 7.3575
287 Pant Dhan19 Uttarakhand, India 5 (74.5) 5 (71) 22.571875 5.7775
288 Pant Dhan18 Uttarakhand, India 7 (79.5) 5 (76) 18.371875 4.9575
289 ADT 47 Tamil Nadu, India 7 (89.5) 5 (71) 16.571875 5.2575
290 Jawahar India 5 (64.5) 5 (61) 26.971875 5.7875
291 Jaya Andhra Pradesh, India 7 (94.5) 7 (96) 19.471875 4.6675
292 CR3622-7-3-2-2 NRRI, Cuttack, India 5 (84.5) 5 (81) 27.871875 6.4275
293 CR3622-7-3-1-1 NRRI, Cuttack, India 5(74.5) 5 (76) 27.271875 6.9575
294 JGL 1798 Andhra Pradesh, India 7 (84.5) 5 (76) 22.171875 4.4275
295 IET 19879 India 7 (69.5) 5 (76) 21.771875 4.2275
296 IET 19985 India 5 (79.50 5 (76) 33.971875 7.1275
297 IET 20538 India 5 (74.5) 3 (76) 37.971875 6.3175
298 IET 20526 India 5 (69.5) 5 (71) 26.571875 5.7475
299 PMK-2 Tamil Nadu, India 7 (64.5) 7 (66) 16.171875 3.6075
300 TKM-11 Tamil Nadu, India 7 (79.5) 7 (86) 16.871875 3.9575
301 IET 20532 India 3 (89.5) 3 (89) 63.771875 11.3875
302 IET 20525 India 3 (85.25) 3 (80.25) 56.896875 11.26
303 IET 20529 India 3 (80.25) 3 (80.25) 56.196875 11.44
304 IET 20559 India 5 (75.25) 3 (70.25) 34.196875 5.77
305 IET 20533 India 5 (70.25) 3 (75.25) 33.396875 6.53
306 Udayagiri Odisha, India 5 (80.25) 5 (85. 25) 23.246875 6.41
307 Sebati Odisha, India 7 (75.25) 7 (70.25) 18.196875 4.39
308 Pavithra Kerala, India 7 (75.25) 7 (70.25) 18.896875 4.74
309 Uma Kerala, India 7 (85.25) 7 (80.25) 16.116875 4.53
310 Kairaly Kerala, india 7 (85.25) 7 (85.25) 16.916875 4.31
311 IET 20540 India 3 (75.25) 3 (75.25) 52.496875 11.43
312 IET 20534 India 5 (65.25) 5 (70.25) 31.596875 6.4
313 IET 20545 India 3 (90.25) 3 (85.25) 55.396875 10.66
314 IET 20556 India 5 (75.25) 3 (70.25) 28.496875 6.83
315 IET 20557 India 3 (88.25) 3 (85.25) 53.796875 10.39
316 IET 20535 India 5 (75.25) 3 (65.25) 38.596875 6.9
317 Sidhanta Odisha, india 7 (90.25) 7 (95.25) 21.696875 4.5
318 Bharani Andhra Pradesh, India 7 (80.25) 7 (85.25) 17.916875 4.74
319 Co-47 Tamil Nadu, India 7 (80.25) 7 (80.25) 14.816875 3.04
320 Jaldi dhan-13 West Bengal, India 5 (75.25) 5 (70.25) 30.796875 7.86
321 GR-9 Gujarat, India 7 (85.25) 7 (85.25) 16.946875 3.82
322 IET 20561 India 3 (75.25) 3 (70.25) 52.796875 9.07
323 IET 20622 India 58 (80.25) 3 (75.25) 35.596875 6.64
324 IET 20601 India 5 (78.25) 3 (75.25) 32.796875 6.86
325 IET 20614 India 5 (85.25) 3 (70.25) 42.096875 6.53
326 IET 19140 India 3 (80.25) 3 (75.25) 42.996875 10.74
327 IET 19972 India 5 (85.25) 5 (80.25) 21.496875 7.5
328 Heera Odisha, India 5 (75.25) 3 (60.25) 60.696875 11.04
329 KalingaIII Odisha, India 5 (85.25) 3 (80.25) 27.396875 7.16
330 Geetanjali Odisha, India 7 (95.25) 7 (95.25) 16.796875 3.9
331 Kamesh Jharkhand, India 3 (75.25) 3 (70.25) 60.496875 7.54
332 Parijat Odisha, India 5 (70.25) 5 (70.25) 23.796875 5.74
333 Naveen Odisha, India 5 (65.25) 5 (60.25) 26.196875 6.53
334 Sadavahar Jharkhand, India 5 (65.25) 3 (70.25) 42.796875 7.03
335 Vanaprava Odisha, India 5 (85.25) 3 (75.25) 34.296875 6.7
336 Abhisek Jharkhand, India 3 (85.25) 3 (80.25) 47.996875 10.5
337 Anjali Jharkhand, India 3 (90.25) 3 (95.25) 58.796875 12.41
338 Phalguni Odisha, India 7 (98.25) 7 (98.25) 23.996875 3.2
339 Samaleswari Chhattisgarh, India 7 (95.25) 7 (90.25) 15.896875 3.63
340 Phule Radha Maharashtra, India 7 (90.25) 7 (95.25) 17.096875 4.4
341 Manaswini Odisha, India 7 (90.25) 7 (88.25) 19.096875 5.03
342 Sahyadri-4 Maharashtra, India 7 (88.25) 7 (85.25) 21.096875 5.43
343 RC Maniphou-6 Manipur, India 7 (80.25) 7 (82.25) 23.796875 6.33
344 Karjat-7 Maharashtra, India 7 (82.25) 7 (84.25) 21.896875 5.98
345 N22 (Tolerant check) Uttar Pradesh, India 1 (98) 1 (98) 83.225 13.24
346 Dular (Tolerant check) Odisha, India 1 (94) 1 (90) 71.825 12.38
347 IR64 (Susceptible check) IRRI, Philippines 7 (82) 7 (80) 9.13 1.85
348 IR20 (Susceptible check) IRRI, Philippines 7 (95) 7 (96) 6.2 1.26
Control treatment means Standard error of difference 1.06346 0.75986 0.54420 0.19385
Tukey's HSD at 5% 8.6645 6.1909 4.4338 1.57938
Test treatment in the same block Standard error of difference 3.00793 2.14920 1.53922 0.54829
Tukey's HSD at 5% 24.5068 17.510 12.5407 4.46716
Test treatment not in the same block Standard error of difference 3.36296 2.40288 1.72090 0.61301
Tukey's HSD at 5% 27.3995 19.5772 14.0209 4.99444
Test treatment and a control treatment Standard error of difference 2.46554 1.76165 1.26167 0.44942
Tukey's HSD at 5% 20.08 14.3529 10.2793 3.66164

Supplemental Table 1. Leaf rolling, leaf drying, spikelet fertility and single plant yield of 348 early and mid-early duration germplasm lines under moderate drought stress.

No. Accession Origin/place of adaption Leaf rolling Leaf drying Spikelet fertility (%) Single plant yield (g)
1 ARC12071 Assam, India 3 (89.25) 3 (84.25) 63.0218 10.55
2 Ac 10984 India 1 (94.25) 1 (89.25) 81.8218 11.57
3 Ac 39800 India 3 (94.25) 3 (89.25) 63.8218 10.15
4 NSIC Rc 106 IRRI, Philippines 7 (84.25) 7 (79.25) 15.8818 4.255
5 Ac 39739 India 3 (89.25) 3 (85.25) 65.1218 9.245
6 HONGZUI EL IRRI, Philippines 7 (89.25) 5 (84.25) 28.271875 6.235
7 Ac 39804 India 3 (94.25) 3 (89.25) 61.321875 10.335
8 Ac 10914 India 1 (95.25) 1 (89.25) 83.121875 12.305
9 Ac 39770 India 3 (92.25) 3 (89.25) 61.821875 9.835
10 BENAMURI Odisha, India 5 (79.25) 3 (79.25) 43.071875 7.525
11 Ac 39737 India 3 (84.25) 3 (84.25) 65.121875 10.345
12 Ac 39955 India 3 (94.25) 3 (89.25) 62.021875 9.935
13 Ac 39843 India 1 (97.25) 1 (94.25) 74.321875 12.355
14 SATHI Utter Pradesh, India 5 (74.25) 3 (79.25) 46.221875 8.355
15 Ac 39769 India 3 (84.25) 3 (87.25) 45.321875 9.555
16 Ac 39933 India 3 (87.25) 3 (89.25) 49.921875 10.975
17 Ac 39794 India 3 (89.25) 3 (91.25) 48.921875 10.535
18 DZ78 IRRI, Philippines 5 (79.25) 5 (84.25) 33.121875 6.775
19 Ac39827 India 5 (74.25) 5 (79.25) 42.721875 6.615
20 Ac 39928 India 5 (84.25) 5 (79.25) 30.121875 5.475
21 Ac 39823 India 5 (89.25) 5 (84.25) 29.221875 5.675
22 SUDUWEE IRRI, Philippines 5 (89.25) 3 (74.25) 41.871875 7.245
23 Ac 39871 India 3 (94.25) 3 (91.25) 49.321875 10.355
24 Ac 39781 India 3 (97.25) 3 (94.25) 61.921875 9.565
25 Ac 39773 India 3 (91.25) 3 (89.25) 49.521875 9.585
26 KHAODAW Thailand 5 (89.25) 3 (87.25) 38.121875 7.115
27 Ac 39795 India 3 (91.25) 3 (89.25) 61.321875 8.975
28 Ac 39776 India 5 (89.25) 5 (84.25) 33.921875 6.375
29 EZI China 5 (95.25) 5 (91.25) 33.121875 5.255
30 Ac 39910 India 5 (91.25) 5 (89.25) 38.421875 6.645
31 Ac 10931 India 3 (94.25) 3 (91.25) 58.821875 9.645
32 MADHABSA Bangadesh 5 (84.25) 5 (79.25) 33.741875 6.225
33 Ac 39749 India 3 (94.25) 3 (91.25) 65.321875 10.355
34 Ac 39792 India 7 (97.25) 7 (96.25) 6.121875 4.205
35 ARC 10319 Assam, India 5 (89.25) 3 (89.25) 36.021875 7.845
36 Ac 10981 India 5 (91.25) 5 (89.25) 19.921875 5.975
37 Ac 39755 India 5 (84.25) 5 (79.25) 20.121875 6.475
38 Ac 39733 India 3 (89.25) 3 (87.25) 61.421875 10.575
39 Ac 39760 India 3 (91.25) 3 (89.25) 46.621875 10.115
40 Ac 10939 India 3 (93.25) 3 (89.25) 63.321875 10.535
41 ARC10818 Assam, India 7 (94.25) 7 (91.25) 21.841875 4.515
42 Ac 11206 India 7 (95.25) 5 (87.25) 6.421875 5.575
43 Ac 39834 India 5 (74.25) 5 (79.25) 20.021875 6.645
44 AL LANKE - 5 (80) 5 (81.5) 30.821875 5.07
45 Ac 10816 India 3 (78) 3 (79.5) 61.721875 9.97
46 Ac 11209 India 7 (85) 5 (79.5) 6.921875 4.87
47 HARBHOOND Madhya Pradesh, India 3 (85) 3 (86.5) 40.921875 8.95
48 Ac 10820 India 3 (90) 3 (91.5) 63.221875 9.07
49 Ac 11261 India 1 (98) 1 (94.5) 81.921875 12.54
50 HAWSHAO IRRI, Philippines 5 (75) 5 (77.5) 23.921875 5.52
51 Ac 10995 India 3 (80) 3 (81.5) 47.321875 9.63
52 Ac 10914 India 7 (98) 7 (94.5) 17.221875 5.05
53 RAY JAZAYKAYZ IRRI, Philippines 3 (88) 3 (84.5) 47.521875 8.51
54 Ac 10837 India 5 (70) 3 (64.5) 38.621875 6.64
55 Ac 11087 India 7 (95) 7 (94.5) 7.521875 4.62
56 AUS 439 Assam, India 5 (82) 5 (79.5) 29.921875 5.87
57 Ac 10843 India 5 (65) 3 (69.5) 40.821875 5.51
58 Ac 10840 India 5 (75) 3 (69.5) 42.121875 5.71
59 Ac 11074 India 7 (95) 7 (91.5) 19.221875 4.95
60 RR 272-17- Jharkhand, India 5 (92) 5 (89.5) 27.921875 5.28
61 Ac 10990 India 5 (85) 5 (81.5) 37.321875 7.24
62 Ac 11462 India 3 (85) 3 (84.5) 58.321875 7.05
63 RAB-56-50 Africa 5 (90) 3 (87.5) 31.921875 6.74
64 Ac 10956 India 5 (92) 5 (89.5) 39.821875 5.02
65 Ac 10811 India 7 (75) 5 (71.5) 16.821875 6.04
66 Ac 10875 India 5 (78) 3 (74.5) 40.921875 5.97
67 Heera Odisha, India 5 (72) 3 (77.5) 40.521875 7.08
68 Ac 11069 India 1 (95) 3 (84.5) 67.421875 9.07
69 Ac 10965 India 3 (90) 3 (87.5) 63.721875 8.08
70 Ac 10857 India 3 (92) 3 (89.5) 46.521875 9.27
71 DASARAMATIA India 5 (78) 3 (74.5) 41.521875 7.28
72 Ac 39911 India 5 (80) 3 (74.5) 33.821875 6.94
73 Ac 39750 India 7 (80) 5 (77.5) 16.821875 6.04
74 Ac 39957 India 3 (85) 3 (84.5) 63.121875 8.74
75 JALIA India 5 (78) 3 (74.5) 35.821875 7.49
76 Ac 10862 India 5 (68) 3 (69.5) 42.521875 6.37
77 Ac 10915 India 3 (85) 3 (84.5) 36.121875 8.75
78 Ac 39870 India 3 (88) 3 (84.5) 37.121875 8.54
79 HASURIDHAN India 5 (90) 5 (84.5) 30.921875 5.93
80 Ac 10994 India 7 (95) 5 (79.5) 17.521875 5.72
81 Ac 10984 India 3 (93) 3 (89.5) 45.621875 9.61
82 CR143-2-2 NRRI, Cuttack, India 1 (98) 1 (94.5) 70.621875 12.65
83 Ac 10954 India 7 (75) 5 (69.5) 18.021875 4.6
84 Ac 39840 India 3 (85) 3 (84.5) 58.321875 9.05
85 SADABAHAR Jharkhand, India 5 (80) 3 (74.5) 36.821875 6.99
86 Ac 10958 India 3 (90) 3 (87.5) 60.621875 9.6
87 Ac 10925 India 7 (92.25) 7 (92) 16.771875 4.775
88 RR347-1 Jharkhand, India 5 (82.25) 3 (80) 41.171875 7.315
89 Ac 10976 India 1 (96.25) 1 (94) 65.471875 12.765
90 Ac 11085 India 5 (85.25) 3 (80) 36.871875 6.465
91 Ac 10957 India 5 (85.25) 3 (85) 34.971875 5.665
92 LALANKANDA-41 India 1 (98.25) 1 (95) 69.471875 11.465
93 Ac 11433 India 3 (92.25) 3 (90) 61.271875 9.445
94 Ac 39975 India 3 (80.25) 1 (85) 64.671875 8.765
95 Ac 11280 India 3 (85.25) 3 (85) 61.771875 8.675
96 Ac 11217 India 3 (90.25) 3 (90) 63.171875 9.865
97 RR-2-6 Jharkhand, India 3 (85.25) 3 (90) 51.571875 10.775
98 Ac 11114 India 7 (85.25) 5 (80) 15.471875 5.665
99 Ac 11328 India 5 (80.25) 3 (78) 38.071875 6.795
100 JOGESH Jharkhand, India 3 (92.25) 3 (92) 45.571875 9.575
101 Ac 11030 India 3 (90.25) 3 (90) 43.071875 8.965
102 Ac 10925 India 1 (95.25) 1 (95) 65.871875 12.665
103 Dinorado Philippines 1 (96.25) 1 (96) 62.371875 13.415
104 Ac 11007 India 3 (90.25) 3 (92) 46.671875 9.435
105 Ac 39890 India 1 (98.25) 1 (95) 82.071875 11.735
106 Ac 11258 India 3 (65.25) 3 (70) 61.771875 9.335
107 RR-348-6 Jharkhand, India 5 (70.25) 3 (80) 39.771875 8.735
108 Ac 11265 India 3 (80.25) 3 (90) 55.071875 9.455
109 Ac 11205 India 3 (85.25) 3 (80) 46.471875 9.275
110 RR-665-645 Jharkhand, India 5 (75.25) 3 (70) 37.171875 8.625
111 Ac 11333 India 3 (70.25) 3 (75) 38.871875 8.665
112 Ac 11246 India 3 (88.25) 3 (85) 36.971875 8.765
113 VANAPRABHA Odisha, India 5 (78.25) 3 (75) 35.571875 7.665
114 Ac 11311 India 3 (90.25) 1 (88) 63.571875 9.535
115 Ac 11057 India 3 (95.25) 3 (90) 47.271875 8.775
116 RR20 Jharkhand, India 5 (90.25) 5 (90) 32.371875 5.845
117 Ac 11464 India 3 (85.25) 3 (80) 48.371875 8.965
118 RR160-10 Jharkhand, India 7 (98.25) 7 (98) 17.231875 4.445
119 RR 51-1 Jharkhand, India 3 (95.25) 3 (95) 52.271875 10.535
120 RR 347-466 Jharkhand, India 7 (98.25) 7 (98) 16.291875 4.735
121 Ac 39963 India 3 (92.25) 3 (92) 63.171875 8.195
122 KHANDAGIRI Odisha, India 3 (95.25) 3 (95) 54.271875 10.575
123 Ac 39753 India 7 (75.25) 5 (70) 19.871875 5.875
124 Ac 39839 India 3 (90.25) 3 (95) 48.871875 9.665
125 BLACKGORA Jharkhand, India 3 (80.25) 3 (90) 51.571875 11.575
126 Ac 39762 India 7 (75.25) 5 (80) 19.471875 4.865
127 RR354-1 Jharkhand, India 3 (90.25) 3 (88) 52.271875 11.565
128 RR 272-1745 Jharkhand, India 3 (92.25) 3 (90) 54.571875 11.575
129 Ac 39973 India 1 (96.25) 1 (95) 82.371875 12.855
130 Ac 10374 India 7 (83.5) 5 (79) 18.946875 5.7525
131 SATYABHAMA Odisha, India 3 (93.5) 3 (89) 63.146875 14.2625
132 Ac 39797 India 3 (86.5) 3 (84) 63.446875 9.5325
133 Ac 10978 India 7 (78.5) 3 (74) 18.146875 5.2025
134 PYARI Odisha, India 3 (93.5) 3 (74) 51.946875 11.5625
135 Ac 10964 India 3 (88.5) 3 (91) 56.246875 8.4225
136 Ac 10972 India 3 (93.5) 3 (89) 62.146875 10.0025
137 CR DHAN204 NRRI, Cuttack, India 5 (73.5) 3 (69) 46.546875 9.7325
138 Ac 10899 India 7 (93.5) 7 (94) 19.046875 3.8625
139 Ac 39759 India 7 (88.5) 5 (79) 19.546875 5.1225
140 Ac 39893 India 3 (93.5) 3 (94) 63.246875 8.5325
141 CR DHAN 202 NRRI, Cuttack, India 3 (90.5) 3 (89) 62.546875 13.1425
142 Ac 10972 India 5 (73.5) 3 (69) 28.846875 6.3325
143 Ac 11152 India 3 (78.5) 3 (84) 63.946875 9.7625
144 Ac 11322 India 3 (83.5) 1 (89) 63.146875 8.1325
145 CR DHAN 201 NRRI, Cuttack, India 5 (78.5) 3 (89) 52.946875 9.3625
146 Ac 10994 India 3 (83.5) 1 (79) 63.546875 7.8625
147 Ac 39790 India 1 (92.5) 1 (89) 81.346875 11.5625
148 Ac 10993 India 5 (82.5) 3 (81) 29.346875 5.4325
149 KALCHI India 5 (84.5) 5 (79) 23.446875 5.0925
150 Ac 11202 India 5 (88.5) 3 (84) 28.746875 4.5625
151 Ac 11208 India 5 (83.5) 3 (81) 26.646875 5.6625
152 Ac 10957 India 3 (90.5) 3 (89) 63.246875 9.2125
153 SETKA India 5 (63.5) 5 (74) 21.646875 5.0925
154 IR10C-137 IRRI, Philippines 3 (83.5) 1 (89) 64.546875 8.3325
155 IR10C-167 IRRI, Philippines 1 (83.5) 1 (79) 80.946875 10.2325
156 IR10C-136 IRRI, Philippines 3 (78.5) 1 (84) 65.246875 7.8625
157 CHINGERDHAN India 3 (88.5) 3 (89) 54.946875 9.3625
158 IR83142-B-36-B IRRI, Philippines 3 (83.5) 1 (79) 61.646875 8.5625
159 IR10C-108 IRRI, Philippines 3 (78.5) 1 (89) 63.546875 11.3325
160 BUNDEI India 3 (73.5) 3 (74) 52.446875 10.4425
161 IR10C-161 IRRI, Philippines 1 (93.5) 1 (89) 66.446875 13.4625
162 SHELLA India 5 (68.5) 3 (79) 36.746875 8.4425
163 CR Dhan 301 NRRI, Cuttack 7 (88.5) 7 (89) 17.946875 3.4425
164 IR10C-110 IRRI, Philippines 3 (83.5) 1 (89) 62.246875 10.7325
165 DHOBOSANKARI India 3 (80.5) 3 (81) 45.946875 9.6425
166 CR Dhan 303 NRRI, Cuttack, India 7 (92.5) 7 (93) 18.546875 3.5025
167 IR10C-179 IRRI, Philippines 3 (73.5) 1 (79) 63.046875 11.5325
168 CR Dhan 304 NRRI, Cuttack, India 7 (88.5) 7 (89) 18.466875 3.1325
169 IR10C-103 IRRI, Philippines 3 (73.5) 1(79) 64.746875 12.2325
170 KARNI India 1 (96.5) 1 (97) 63.146875 12.1825
171 CR Dhan 305 NRRI, Cuttack, India 5 (80.5) 5 (79) 27.546875 6.4625
172 IR10C-126 IRRI, Philippines 3 (83.5) 1 (79) 62.446875 10.5325
173 DENGBOREI Eastern India 3 (80.25) 3 (75) 52.046875 10.865
174 IR10G-103 IRRI, Philippines 1 (85.25) 1 (80) 65.846875 13.885
175 CR Dhan 306 NRRI, Cuttack, India 7 (90.25) 7 (90) 15.946875 3.215
176 SEKRE EasternIndia 7 (85.25) 7 (85) 18.146875 3.345
177 Maudamani NRRI, Cuttack, India 7 (98.25) 7 (98) 15.146875 3.585
178 CR Dhan 309 NRRI, Cuttack, India 7 (98.25) 7 (95) 17.746875 4.685
179 CR Dhan 205 NRRI, Cuttack, India 5 (85.25) 3 (75) 43.046875 8.925
180 TAWADHAN Northern India 5 (75.25) 3 ( 70) 40.246875 8.715
181 IR83141-B-32-B IRRI, Philippines 3 (85.25) 1 (80) 63.746875 13.625
182 IR64197-3B-15-2 IRRI, Philippines 3 (85.25) 1 (85) 63.946875 13.295
183 CR Dhan 206 NRRI, Cuttack, India 5 (92.25) 5 (90) 33.346875 7.985
184 KUTIARASI India 3 (95.25) 3 (92) 60.746875 12.915
185 CR Dhan 207 NRRI, Cuttack, India 5 (85.25) 3 (65) 38.146875 8.715
186 SEKRADHAN India 3 (85.25) 3 (85) 56.046875 10.715
187 IR10C-157 IRRI, Philippines 3 (90.25) 3 (88) 60.846875 5.745
188 GURUJIDHAN India 7 (80.25) 5 (80) 28.346875 9.925
189 Lalat Odisha, India 7 (85.25) 5 (85) 26.746875 5.745
190 KASALATH Bangladesh 3 (80.25) 3 (80) 60.446875 10.425
191 Satyakrishna Odisha, India 7 (90.25) 5 (80) 16.146875 4.745
192 Sahabhagi Dhan Odisha, india 1 (95.25) 1 (90) 65.846875 14.425
193 Satabdi West Bengal, India 7 (95.25) 7 (95) 18.346875 3.085
194 KUSUMA Odisha, India 3 (90.25) 3 (90) 46.146875 9.925
195 Annapurna Odisha, India 5 (80.25) 5 (80) 22.846875 5.425
196 Surendra Odisha, India 5 (85.25) 5 (82) 24.346875 4.945
197 BASARAMATIA India 5 (75.25) 3 (60) 35.246875 5.565
198 Birupa Odisha, India 5 (80.25) 5 (70) 27.946875 4.745
199 Naveen Odisha, India 5 (90.25) 5 (95) 23.846875 5.755
200 Bowdel India 1 (95.25) 1 (90) 68.046875 12.665
201 IR 72 IRRI, Phillippines 5 (75.25) 5 (75) 31.246875 4.285
202 LALSANKRI India 1 (90.25) 1 (90) 61.146875 11.365
203 CR2340-2 NRRI, Cuttack, India 1 (98.25) 1 (95) 81.546875 10.315
204 TEPIBORO Assam, India 1 (95.25) 1 (95) 44.246875 10.315
205 BORI India 3 (90.25) 3 (90) 50.846875 9.925
206 CR2340-1 NRRI, Cuttack, India 3 (75.25) 1 (70) 61.946875 11.625
207 Vijetha Andhra Pradesh, India 7 (70.25) 5 (75) 26.946875 5.325
208 SURJAMUKHI India 1 (95.25) 1 (95) 64.446875 12.955
209 Divya India 5 (80.25) 3 (85) 29.146875 4.645
210 Pusa 44 Uttar Pradesh, India 7 (85.25) 5 (80) 21.946875 3.275
211 FULLKATI India 3 (85.25) 3 (85) 55.746875 9.685
212 MENKASALA India 3 (90.25) 3 (90) 48.146875 10.385
213 ADT 43 Tamil Nadu, India 7 (75.25) 5 (80) 23.046875 4.715
214 CR2463-25 NRRI, Cuttack 5 (80.25) 5 (90) 27.746875 5.315
215 Khitish West Bengal, India 5 (70.25) 5 (70) 23.346875 4.715
216 Shaktiman Odisha, India 5 (67) 5 (71) 27.321875 5.035
217 MURIDANRA India 3 (82) 3 (71) 49.121875 10.685
218 BAILAM Bangladesh 3 (82) 3 (83) 54.121875 11.465
219 Bhoi Odisha, india 7 (87) 5 (81) 23.021875 5.525
220 RAISARIA India 3 (72) 3 (76) 53.421875 11.565
221 Indira Odisha, India 5 (62) 5 (66) 24.721875 4.215
222 Ratna Odisha, India 5 (67) 5 (61) 23.121875 5.285
223 SERETY Korea 3 (87) 3 (81) 63.421875 12.565
224 Konark Odisha, India 5 (77) 5 (71) 24.321875 5.415
225 Prasad India 5 (67) 5 (61) 25.421875 6.415
226 DV123 IRRI, Philippines 3 (77) 3 (71) 54.521875 11.865
227 BORO 4005 NRRI, Cuttack, India 5 (87) 5 (81) 32.021875 5.045
228 CR3813-4-4-4-2-2 NRRI, Cuttack, India 1 (82) 1 (86) 72.321875 11.425
229 BG301 Sri Lanka 3 (77) 3 (71) 53.521875 11.765
230 Jajati Odisha, India 7 (92) 5 (71) 22.021875 4.345
231 Radhi Odisha, India 7 (82) 5 (71) 25.721875 5.375
232 MANDRIRA IRRI, Philippine 3 (87) 3 (81) 61.621875 10.705
233 Sravani Odisha, India 7 (92) 5 (71) 24.721875 5.485
234 Sasyasree Odisha, India 7 (87) 5 (71) 23.821875 5.315
235 Gajapati Odisha, India 7 (92) 7 (91) 20.321875 4.715
236 Bhavani Odisha, India 7 (82) 5 (66) 29.721875 4.385
237 CSR90 Haryana, India 5 (82) 5 (86) 24.321875 6.705
238 IR 50 IRRI, Philippines 7 (92) 7 (91) 20.721875 4.415
239 CR3820-4-5-5-3-1 NRRI, Cuttack, India 7 (82) 5 (76) 33.221875 5.485
240 Tapaswini Odisha, India 7 (87) 7 (81) 20.421875 4.315
241 YN1353-3 IRRI, Philippines 3 (87) 3 (81) 53.521875 10.525
242 Ananga Odisha, India 7 (87) 7 (81) 21.121875 5.415
243 Chandan Odisha, india 5 (87) 3 (81) 29.621875 6.415
244 HABIGONJ BORO6 Bangladesh 3 (67) 3 (56) 65.121875 12.465
245 CR3621-6-1-3-1-2 NRRI, Cuttack, india 3 (77) 3 (81) 49.321875 8.525
246 Satabdi West Bengal, Odisha 7 (100) 7 (99) 20.821875 4.485
247 BAMAWPYAN IRRI, Philippine 1 (92) 1 (91) 64.421875 11.765
248 Kshira Odisha, india 7 (87) 7 (81) 19.021875 5.305
249 CR 2461-9 NRRI, Cuttack, india 5 (92) 3 (71) 39.121875 7.415
250 IR 8 IRRI, Philippines 7 (92) 5 (76) 21.921875 5.015
251 Gouri Odisha, India 7 (97) 7 (93) 19.721875 4.745
252 Vikramarya India 5 (77) 5 (71) 24.021875 5.615
253 CR Dhan 208 NRRI, Cuttack, India 5 (77) 3 (66) 43.121875 8.815
254 Luit Assam, India 5 (87) 5 (91) 22.821875 4.855
255 CO 43 Tamil Nadu, India 7 (92) 7 (91) 16.821875 5.675
256 Kalyani 2 Odisha, India 7 (77) 5 (61) 28.621875 8.785
257 Kalakeri Jharkhand, India 3 (87) 3 (86) 67.721875 11.025
258 Browngora Jharkhand, India 3 (94) 3 (91) 54.221875 10.525
259 CR3825-2-1-2-2-4 NRRI, Cuttack, India 5 (74.5) 5 (81) 23.971875 5.3275
260 Sneha Odisha, India 7 (91.5) 7 (91) 17.571875 4.3875
261 Lalnakanda India 3 (84.5) 1 (81) 64.471875 10.7675
262 LAXMIKAJAL India 3 (84.5) 1 (86) 52.971875 9.6675
263 CR 143-2-2 NRRI, Cuttack, India 1 (94.5) 1 (96) 80.471875 12.3875
264 WAB 56-50 Africa 5 (69.5) 5 (76) 26.371875 7.4475
265 WITA 10 Africa 5 (64.5) 5 (61) 33.971875 7.3675
266 Govind Uttar Pradesh, India 7 (84.5) 5 (76) 27.371875 5.3575
267 KASARAKUNDA India 3 (74.5) 3 (66) 51.671875 10.7575
268 CR Dhan 601 Odisha, India 5 (69.5) 5 (76) 42.271875 7.6675
269 Rasi Andhra Pradesh, India 3 (79.5) 3 (76) 48.071875 9.4775
270 CR3825-2-1-2-2-3 NRRI, Cuttack, India 5 (74.5) 3 (71) 34.971875 6.4675
271 Jyothi Kerala, India 5 (74.5) 3 (66) 27.071875 4.6575
272 Nidhi Tamil Nadu, India 7 (84.5) 7 (81) 16.971875 3.3575
273 PUNEI India 3 (64.5) 3 (61) 41.671875 8.7975
274 CR3820-4-5-3-1-3 NRRI, Cuttack, India 7 (89.5) 7 (91) 41.371875 3.3575
275 ADT 45 Tamil Nadu, India 7 (84.5) 5 (76) 23.971875 5.6675
276 DUMERPHULLI India 3 (74.5) 3 (81) 53.771875 11.5075
277 Ratnagiri 3 Maharashtra, India 5 (79.5) 5 (86) 27.471875 6.4275
278 Mahamaya Chhattisgarh, India 7 (74.5) 5 (66) 21.671875 5.7875
279 LAHDIL India 3 (74.5) 3 (71) 48.171875 9.9775
280 Kushal India 5 (59.5) 5 (66) 25.071875 6.4975
281 CR3621-6-1-3-1-1 NRRI, Cuttack, India 5 (84.5) 3 (83) 34.071875 6.5575
282 HAZARIDHAN Jharkhand, India 3 (89.5) 3 (86) 42.171875 8.6675
283 CR3820-2-1-5-1-2 NRRI, Cuttack, India 5 (84.5) 5 (81) 25.271875 6.3475
284 KALINGA II Odisha, India 5 (74.5) 3 (71) 39.171875 8.2675
285 Bhadra India 5 (64.5) 5 (66) 28.771875 5.3475
286 CR3826-8-3-2-1-1 NRRI, Cuttack, India 5 (74.5) 5 (71) 28.571875 7.3575
287 Pant Dhan19 Uttarakhand, India 5 (74.5) 5 (71) 22.571875 5.7775
288 Pant Dhan18 Uttarakhand, India 7 (79.5) 5 (76) 18.371875 4.9575
289 ADT 47 Tamil Nadu, India 7 (89.5) 5 (71) 16.571875 5.2575
290 Jawahar India 5 (64.5) 5 (61) 26.971875 5.7875
291 Jaya Andhra Pradesh, India 7 (94.5) 7 (96) 19.471875 4.6675
292 CR3622-7-3-2-2 NRRI, Cuttack, India 5 (84.5) 5 (81) 27.871875 6.4275
293 CR3622-7-3-1-1 NRRI, Cuttack, India 5(74.5) 5 (76) 27.271875 6.9575
294 JGL 1798 Andhra Pradesh, India 7 (84.5) 5 (76) 22.171875 4.4275
295 IET 19879 India 7 (69.5) 5 (76) 21.771875 4.2275
296 IET 19985 India 5 (79.50 5 (76) 33.971875 7.1275
297 IET 20538 India 5 (74.5) 3 (76) 37.971875 6.3175
298 IET 20526 India 5 (69.5) 5 (71) 26.571875 5.7475
299 PMK-2 Tamil Nadu, India 7 (64.5) 7 (66) 16.171875 3.6075
300 TKM-11 Tamil Nadu, India 7 (79.5) 7 (86) 16.871875 3.9575
301 IET 20532 India 3 (89.5) 3 (89) 63.771875 11.3875
302 IET 20525 India 3 (85.25) 3 (80.25) 56.896875 11.26
303 IET 20529 India 3 (80.25) 3 (80.25) 56.196875 11.44
304 IET 20559 India 5 (75.25) 3 (70.25) 34.196875 5.77
305 IET 20533 India 5 (70.25) 3 (75.25) 33.396875 6.53
306 Udayagiri Odisha, India 5 (80.25) 5 (85. 25) 23.246875 6.41
307 Sebati Odisha, India 7 (75.25) 7 (70.25) 18.196875 4.39
308 Pavithra Kerala, India 7 (75.25) 7 (70.25) 18.896875 4.74
309 Uma Kerala, India 7 (85.25) 7 (80.25) 16.116875 4.53
310 Kairaly Kerala, india 7 (85.25) 7 (85.25) 16.916875 4.31
311 IET 20540 India 3 (75.25) 3 (75.25) 52.496875 11.43
312 IET 20534 India 5 (65.25) 5 (70.25) 31.596875 6.4
313 IET 20545 India 3 (90.25) 3 (85.25) 55.396875 10.66
314 IET 20556 India 5 (75.25) 3 (70.25) 28.496875 6.83
315 IET 20557 India 3 (88.25) 3 (85.25) 53.796875 10.39
316 IET 20535 India 5 (75.25) 3 (65.25) 38.596875 6.9
317 Sidhanta Odisha, india 7 (90.25) 7 (95.25) 21.696875 4.5
318 Bharani Andhra Pradesh, India 7 (80.25) 7 (85.25) 17.916875 4.74
319 Co-47 Tamil Nadu, India 7 (80.25) 7 (80.25) 14.816875 3.04
320 Jaldi dhan-13 West Bengal, India 5 (75.25) 5 (70.25) 30.796875 7.86
321 GR-9 Gujarat, India 7 (85.25) 7 (85.25) 16.946875 3.82
322 IET 20561 India 3 (75.25) 3 (70.25) 52.796875 9.07
323 IET 20622 India 58 (80.25) 3 (75.25) 35.596875 6.64
324 IET 20601 India 5 (78.25) 3 (75.25) 32.796875 6.86
325 IET 20614 India 5 (85.25) 3 (70.25) 42.096875 6.53
326 IET 19140 India 3 (80.25) 3 (75.25) 42.996875 10.74
327 IET 19972 India 5 (85.25) 5 (80.25) 21.496875 7.5
328 Heera Odisha, India 5 (75.25) 3 (60.25) 60.696875 11.04
329 KalingaIII Odisha, India 5 (85.25) 3 (80.25) 27.396875 7.16
330 Geetanjali Odisha, India 7 (95.25) 7 (95.25) 16.796875 3.9
331 Kamesh Jharkhand, India 3 (75.25) 3 (70.25) 60.496875 7.54
332 Parijat Odisha, India 5 (70.25) 5 (70.25) 23.796875 5.74
333 Naveen Odisha, India 5 (65.25) 5 (60.25) 26.196875 6.53
334 Sadavahar Jharkhand, India 5 (65.25) 3 (70.25) 42.796875 7.03
335 Vanaprava Odisha, India 5 (85.25) 3 (75.25) 34.296875 6.7
336 Abhisek Jharkhand, India 3 (85.25) 3 (80.25) 47.996875 10.5
337 Anjali Jharkhand, India 3 (90.25) 3 (95.25) 58.796875 12.41
338 Phalguni Odisha, India 7 (98.25) 7 (98.25) 23.996875 3.2
339 Samaleswari Chhattisgarh, India 7 (95.25) 7 (90.25) 15.896875 3.63
340 Phule Radha Maharashtra, India 7 (90.25) 7 (95.25) 17.096875 4.4
341 Manaswini Odisha, India 7 (90.25) 7 (88.25) 19.096875 5.03
342 Sahyadri-4 Maharashtra, India 7 (88.25) 7 (85.25) 21.096875 5.43
343 RC Maniphou-6 Manipur, India 7 (80.25) 7 (82.25) 23.796875 6.33
344 Karjat-7 Maharashtra, India 7 (82.25) 7 (84.25) 21.896875 5.98
345 N22 (Tolerant check) Uttar Pradesh, India 1 (98) 1 (98) 83.225 13.24
346 Dular (Tolerant check) Odisha, India 1 (94) 1 (90) 71.825 12.38
347 IR64 (Susceptible check) IRRI, Philippines 7 (82) 7 (80) 9.13 1.85
348 IR20 (Susceptible check) IRRI, Philippines 7 (95) 7 (96) 6.2 1.26
Control treatment means Standard error of difference 1.06346 0.75986 0.54420 0.19385
Tukey's HSD at 5% 8.6645 6.1909 4.4338 1.57938
Test treatment in the same block Standard error of difference 3.00793 2.14920 1.53922 0.54829
Tukey's HSD at 5% 24.5068 17.510 12.5407 4.46716
Test treatment not in the same block Standard error of difference 3.36296 2.40288 1.72090 0.61301
Tukey's HSD at 5% 27.3995 19.5772 14.0209 4.99444
Test treatment and a control treatment Standard error of difference 2.46554 1.76165 1.26167 0.44942
Tukey's HSD at 5% 20.08 14.3529 10.2793 3.66164
Supplemental Table 2. List of markers used in the study.
Name Forward (5'-3') Reverse (5'-3') Gene Reference
RM6089 CCACCGAATCGAATAACCAC ATGGCCAGCGTGATCTCC Dro2 Uga et al.(2013)
ID07_14 CCATGATCAAACCACACAGC TGTCAGGGCACCATGACTTA Dro1 Uga et al.(2008)
ID12_17 ACCGTAGCGTTAGCATGGAC ACTACGAGAATGCGGTGCTT Dro1 Uga et al.(2008)
RM24393 TAGCTGCTTAGCTTTGACTTGG ATGTAATCCTACGAGGAGATCG Dro1 Uga et al. (2010)
RM7424 AGAAGCCCATCTAGCAGCAG TCAAGCTAGCCACACAGCTG Dro1 Uga et al.(2010)
SNP02-KP GTCTAGATCACG-CAGTGAAT TCGCATGATGATGACCAAGT Dro1 Uga et al.(2013)
SNP02-IR64 ATCGTCTAGATCACGCATGAAC AGGGTGGCTTTACCTCCGTA Dro1 Uga et al.(2013)
Dro1-CAPS5 GCACAAGATGGGAGGAGAGT CATGGGTGAGAATCGTGTTG Dro1 Uga et al.(2013)
Dro1-INDEL GCAGACGCTCGTAACACGTA GT-GGCAGCTCCATCAACTCT Dro1 Uga et al.(2013)

Supplemental Table 2. List of markers used in the study.

Name Forward (5'-3') Reverse (5'-3') Gene Reference
RM6089 CCACCGAATCGAATAACCAC ATGGCCAGCGTGATCTCC Dro2 Uga et al.(2013)
ID07_14 CCATGATCAAACCACACAGC TGTCAGGGCACCATGACTTA Dro1 Uga et al.(2008)
ID12_17 ACCGTAGCGTTAGCATGGAC ACTACGAGAATGCGGTGCTT Dro1 Uga et al.(2008)
RM24393 TAGCTGCTTAGCTTTGACTTGG ATGTAATCCTACGAGGAGATCG Dro1 Uga et al. (2010)
RM7424 AGAAGCCCATCTAGCAGCAG TCAAGCTAGCCACACAGCTG Dro1 Uga et al.(2010)
SNP02-KP GTCTAGATCACG-CAGTGAAT TCGCATGATGATGACCAAGT Dro1 Uga et al.(2013)
SNP02-IR64 ATCGTCTAGATCACGCATGAAC AGGGTGGCTTTACCTCCGTA Dro1 Uga et al.(2013)
Dro1-CAPS5 GCACAAGATGGGAGGAGAGT CATGGGTGAGAATCGTGTTG Dro1 Uga et al.(2013)
Dro1-INDEL GCAGACGCTCGTAACACGTA GT-GGCAGCTCCATCAACTCT Dro1 Uga et al.(2013)
Fig. 1. Frequency distributions of leaf rolling, leaf drying, spikelet fertility and single plant yield among 348 genotypes under moderate drought stress.

Fig. 1. Frequency distributions of leaf rolling, leaf drying, spikelet fertility and single plant yield among 348 genotypes under moderate drought stress.

Fig. 2. Representative pictures of gravitropic response of primary roots of Dro positive genotypes by using agarose-glass box method along with negative check IR64.A, KalingaIII. B, Lalsankari. C, Dular. D, N22. E, Kasalath. F-H, IR64.

Fig. 2. Representative pictures of gravitropic response of primary roots of Dro positive genotypes by using agarose-glass box method along with negative check IR64.A, KalingaIII. B, Lalsankari. C, Dular. D, N22. E, Kasalath. F-H, IR64.

Fig. 3. Frequency distribution of mean root angle of the panel population in response to gravitropic effect (A) and primary mean root angle of genotypes having both Dro1 and Dro2 along with negative check IR64 (B).

Fig. 3. Frequency distribution of mean root angle of the panel population in response to gravitropic effect (A) and primary mean root angle of genotypes having both Dro1 and Dro2 along with negative check IR64 (B).

Supplemental Fig. 1 Representative electrophoregram obtained with ID07_14 showing target band of 174 bp. The numbers represent the genotypes listed in Table 2.

Supplemental Fig. 1 Representative electrophoregram obtained with ID07_14 showing target band of 174 bp. The numbers represent the genotypes listed in Table 2.

Supplemental Fig 2. Amplicons obtained with RM6089. The Orange arrow indicates the target allele in Dular (170bp) and the blue arrow indicates IR64 allele (165bp). The numbers represent the genotypes listed in Table 2.

Supplemental Fig 2. Amplicons obtained with RM6089. The Orange arrow indicates the target allele in Dular (170bp) and the blue arrow indicates IR64 allele (165bp). The numbers represent the genotypes listed in Table 2.

Fig. 4. Graph of K value, an ad-hoc statistic related to the rate of change in the log probability of data between successive K values (A), and population structure of 101 germplasm lines based on membership probability fractions of individual genotypes (B) and population structure of 101 germplasm lines sorted based on serial number of the genotypes (C).

Fig. 4. Graph of K value, an ad-hoc statistic related to the rate of change in the log probability of data between successive K values (A), and population structure of 101 germplasm lines based on membership probability fractions of individual genotypes (B) and population structure of 101 germplasm lines sorted based on serial number of the genotypes (C).

Fig. 5. Principal coordinate analysis (A) and unweighted pair group method arithmatic average (UPGMA) algorithm (B) obtained with the molecular markers for Dro1 and Dro2 loci of 101 genotypes. The dot numbers in the figure represent the serial number of the genotypes.

Fig. 5. Principal coordinate analysis (A) and unweighted pair group method arithmatic average (UPGMA) algorithm (B) obtained with the molecular markers for Dro1 and Dro2 loci of 101 genotypes. The dot numbers in the figure represent the serial number of the genotypes.

参考文献 37

[1] Barik S R, Pandit E, Pradhan S K, Singh S, Swain P, Mohapatra T. 2018. QTL mapping for relative water content trait at reproductive stage drought stress in rice. Ind J Genet, 78(4): 401-408.
[2] Barik S R, Pandit E, Pradhan S K, Mohanty S P, Mohapatra T. 2019. Genetic mapping of morpho-Physiological traits involved during reproductive stage drought tolerance in rice. PLoS One, 14(12): e0214979.
[3] Bernier J, Serraj R, Kumar A, Venuprasad R, Impa S, Gowdaa R P V, Oane R, Spaner D, Atlin G. 2009. The large-effect drought- resistance QTL qtl12.1 increases water uptake in upland rice. Field Crops Res, 110(2): 139-146.
[4] Chang T T, Loresto G C, Tagumpay O. 1974. Screening of rice germplasm for drought resistant. Sabrao J, 6(1): 9-16.
[5] Chin J H, Lu X C, Haefele S M, Gamuyao R, Ismail A, Wissuwa M, Heuer S. 2010. Development and application of gene-based markers for the major rice QTL phosphorus uptake 1. Theor Appl Genet, 120: 1073-1086.
[6] Chin J H, Gamuyao R, Dalid C, Bustamam M, Prasetiyono J, Moeljopawiro S, Wissuwa M, Heuer S. 2011. Developing rice with high yield under phosphorus deficiency: Pup1 sequence to application. Plant Physiol, 156(3): 1202-1216.
[7] Davatgar N, Neishabouri M R, Sepaskhah A R, Soltani A. 2009. Physiological and morphological responses of rice (Oryza sativa L.) to varying water stress management strategies. Int J Plant Prod, 3(4): 19-32.
[8] Earl D A, von Holdt B M. 2012. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv Genet Res, 4(2): 359-361.
[9] Evanno G, Regnaut S, Goudet J. 2005. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol Ecol, 14(8): 2611-2620.
[10] Farooq M, Kobayashi N, Ito O, Wahid A, Serraj R. 2010. Broader leaves result in better performance of indica rice under drought stress. J Plant Physiol, 167(13): 1066-1075.
[11] Fukai S, Cooper M. 1995. Development of drought resistant cultivars using physio-morphological traits in rice. Field Crops Res, 40(2): 67-86.
[12] Hsiao T C. 1973. Plant responses to water stress. Ann Rev Plant Physiol, 24: 519-570.
[13] Henry A, Gowda V R P, Torres R O, McNally K L, Serraj R. 2011. Variation in root system architecture and drought response in rice ( Oryza sativa): Phenotyping of the Oryza SNP panel in rainfed lowland fields. Field Crops Res, 120(2): 205-214.
[14] IRRI (International Rice Research Institute). 2013. SES (Standard Evaluation System for Rice). International Network for Genetic Evaluation of Rice. Los Baños, the Philippines: International Rice Research Institute.
[15] Kang Y H, Khan S, Ma X Y. 2009. Climate change impacts on crop yield, crop water productivity and food security: A review. Prog Nat Sci, 19: 1665-1674.
[16] Kato Y, Abe J, Kamoshita A. Yamagishi J. 2006. Genotypic variation in root growth angle in rice (Oryza sativa L.) and its association with deep root development in upland fields with different water regimes. Plant Soil, 287: 117-129.
[17] Kitomi Y, Kanno N, Kawai S, Mizubayashi T, Fukuoka S, Uga Y. 2015. QTLs underlying natural variation of root growth angle among rice cultivars with the same functional allele of deeper rooting. Rice, 18: 16.
[18] Kondo M, Murty M V R, Aragones D V. 2000. Characteristics of root growth and water uptake from soil in upland rice and maize under water stress. Soil Sci Plant Nutr, 46(3): 721-732.
[19] Kumar R, Sarawgi A K, Ramos C, Amarante S T, Ismail A M, Wade L J. 2006. Partioning of dry matter during drought stress in rainfed lowland rice. Field Crops Res, 96: 455-465.
[20] Kumar R, Sreenu K, Singh N, Jain N, Singh N K, Rai V. 2015. Effect of drought stress on contrasting cultivars of rice. Int J Trop Agric, 33(2): 1559-1564.
[21] McKersie B. 2015. Planning for food security in a changing climate. J Exp Bot, 66: 3435-3450.
[22] Pandit E, Sahoo A, Panda R K, Mohanty D P, Pani D R, Anandan A, Pradhan S K. 2016. Survey of rice cultivars and landraces of upland ecology for Phosphorous uptake 1 ( Pup1) QTL using linked and gene specific molecular markers. Oryza, 53(1): 1-9.
[23] Pandit E, Panda R K, Pani D R, Chandra R, Singh S, Pradhan S K. 2018. Molecular marker and phenotypic analyses for low phosphorus stress tolerance in cultivars and landraces of upland rice under irrigated and drought situations. Ind J Genet, 78(1): 59-68.
[24] Pennisi E. 2008. The blue revolution, drop by drop, gene by gene. Science, 320: 171-173.
[25] Perrier X, Jacquemoud-Collet J P. 2006. DARwin software. .
[26] Pradhan S K, Barik S R, Sahoo A, Mohapatra S, Nayak D K, Mahender A, Meher J, Anandan A, Pandit E. 2016. Population structure, genetic diversity and molecular marker-trait association analysis for high temperature stress tolerance in rice. PLoS One, 11(8): e0160027.
[27] Pritchard J K, Stephens M, Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics, 155(2): 945-959.
[28] Singh H, Mackill K T. 1991. Senstivity of rice to water deficit at different growth stages. Phil Crop Sci, 16: S11.
[29] Singh C S, Kumar B, Mehandi S, Chandra K. 2012. Effect of drought stress in rice: A review on morphological and physiological characteristics. Trends Biosci, 5(4): 261-265.
[30] Torres R O, Henry A. 2018. Yield stability of selected rice breeding lines and donors across conditions of mild to moderately severe drought stress. Field Crops Res, 220: 37-45.
[31] Uga Y, Okuno K, Yano M. 2011. Dro1, a major QTL involved in deep rooting of rice under upland field conditions. J Exp Bot, 62(8): 2485-2494.
[32] Uga Y, Hanzawa E, Nagai S, Sasaki K, Yano M, Sato T. 2012. Identification of qSOR1, a major rice QTL involved in soil- surface rooting in paddy fields. Theor Appl Genet, 124(1): 75-86.
[33] Uga Y, Sugimoto K, Ogawa S, Rane J, Ishitani M, Hara N, Kitomi Y, Inukai Y, Ono K, Kanno N, Inoue H, Takehisa H, MotoyamaR, Nagamura Y, Wu J, Matsumoto T, Takai T, Okuno K, Yano M. 2013a. Control of root system architecture by deeper rooting 1 increases rice yield under drought conditions. Nat Genet, 45(9): 1097-1102.
[34] Uga Y, Yamamoto E, Kanno N, Kawai S, Mizubayashi T, Fukuoka S. 2013b. A major QTL controlling deep rooting on rice chromosome 4. Sci Rep, 3: 3040.
[35] Wissuwa M, Noriharu A. 2001. Further characterization of two QTLs that increase phosphorous uptake of rice (Oryza sativa L.) under phosphorous deficiency. Plant Soil, 237(2): 275-286.
[36] Yang M Z, Xiao W H, Zhao Y, Li X D, Huang Y, Lu F, Hou B D, Li B Q. 2018. Assessment of potential climate change effects on the rice yield and water footprint in the Nanliujiang catchment, China. Sustainability, 10(2): 242.
[37] Yoshida S, Hasegawa S. 1982. The rice root system: Its development and function. In: Drought resistance in crops with emphasis on rice. Los Banos, the Philippines: International Rice Research Institute: 97-114.

相关文章 0

No related articles found!

编辑推荐

Metrics

阅读次数
全文


摘要

  • 摘要
  • 图/表
  • 参考文献
  • 相关文章
  • 编辑推荐
  • Metrics
回顶部
浙ICP备05004719号-15   公安备案号:33010302003355
版权所有 © 《Rice Science》编辑部
地址:浙江省杭州市体育场路359号 邮编:310006 电话:0571-63371017 E-mail:crrn@fy.hz.zn.cn; cjrs278@gmail.com
本系统由北京玛格泰克科技发展有限公司设计开发
总访问量: 今日访问: 在线人数: