Rice Science ›› 2016, Vol. 23 ›› Issue (3): 160-164.DOI: 10.1016/j.rsci.2016.04.003
• • 上一篇
收稿日期:2015-07-08
接受日期:2016-02-02
出版日期:2016-06-08
发布日期:2016-02-04
. [J]. Rice Science, 2016, 23(3): 160-164.
| Marker | Chromosome | Forward primer | Reverse primer | Annealing temperature (°C) |
|---|---|---|---|---|
| RM315 | 1 | GAGGTACTTCCTCCGTTTCAC | AGTCAGCTCACTGTGCAGTG | 55 |
| RM443 | 1 | GATGGTTTTCATCGGCTACG | AGTCCCAGAATGTCGTTTCG | 55 |
| RM171 | 10 | AACGCGAGGACACGTACTTAC | ACGAGATACGTACGCCTTTG | 67 |
| RM258 | 10 | TGCTGTATGTAGCTCGCACC | TGGCCTTTAAAGCTGTCGC | 55 |
Table 1 SSR primer pairs with their chromosomal locations and annealing temperatures.
| Marker | Chromosome | Forward primer | Reverse primer | Annealing temperature (°C) |
|---|---|---|---|---|
| RM315 | 1 | GAGGTACTTCCTCCGTTTCAC | AGTCAGCTCACTGTGCAGTG | 55 |
| RM443 | 1 | GATGGTTTTCATCGGCTACG | AGTCCCAGAATGTCGTTTCG | 55 |
| RM171 | 10 | AACGCGAGGACACGTACTTAC | ACGAGATACGTACGCCTTTG | 67 |
| RM258 | 10 | TGCTGTATGTAGCTCGCACC | TGGCCTTTAAAGCTGTCGC | 55 |
Fig. 1. Banding pattern of markers linked with Rf3 (A and C) and Rf4 (B and D) in cultivars and breeding lines. A, RM443; B, RM171; C, RM315; D, RM258. R, Restorer; NR, Non restorer.
| Cross | Pollen fertility | Spikelet fertility | Days to 50% | Plant height | Grain yield |
|---|---|---|---|---|---|
| (%) | (%) | flowering (d) | (cm) | per plant (g) | |
| IR58025A/ARH10-1-3-2-2-1 | 93.1 | 90.3 | 101.3 | 106.2 | 47.3 |
| IR58025A/ARH11-1-3-3-2-1 | 85.7 | 86.4 | 92.4 | 97.3 | 38.4 |
| IR58025A/ARH15-1-3-4-1-2 | 89.4 | 85.6 | 112.6 | 117.5 | 36.6 |
| IR58025A/ARH13-1-3-5-1-2 | 83.9 | 87.7 | 90.7 | 95.6 | 48.7 |
| IR58025A/ARH14-2-1-2-6-1 | 86.2 | 90.8 | 105.8 | 110.7 | 49.8 |
| IR58025A/ARH6-2-2-3-1-3 | 94.5 | 88.9 | 93.9 | 98.8 | 51.9 |
| IR58025A/ARH7-2-2-4-2-1 | 93.8 | 90 | 101 | 105.9 | 47 |
| IR58025A/ARH8-2-2-5-2-3 | 82.4 | 82.1 | 94.1 | 99 | 40.1 |
| IR58025A/ARH9-1-3-1-1-2 | 95 | 92.2 | 94.2 | 99.1 | 39.2 |
| IR28025A/ARH12-13-2-B-B-1-1 | 90.51 | 94.23 | 92.5 | 97.4 | 32.9 |
| IR28025A/ARH12-6-1-1-B-3-1 | 97.39 | 95.1 | 101.1 | 106 | 38.8 |
| IR28025A/ARH15-12-1-1-B-2-1 | 87.7 | 90.93 | 86.6 | 91.5 | 34.3 |
| IR28025A/ARH21-5-B-2-1 | 94.65 | 94.06 | 100.7 | 105.6 | 36.7 |
| IR28025A/ARH22-2-1-B-1-1 | 84.01 | 83.07 | 97.6 | 102.5 | 36.3 |
| IR28025A/ARH41-23-2-1-1-2 | 93.52 | 93.08 | 97.3 | 102.2 | 48.5 |
| IR28025A/ARH42-2-2-2-1-2 | 95.59 | 93.41 | 90.9 | 95.8 | 35.1 |
| IR28025A/ARH43-2-1-1-2 | 99.08 | 92.41 | 101.5 | 106.4 | 73.7 |
| IR28025A/ARH46-6-6-1-1 | 97 | 93.37 | 91.6 | 96.5 | 49.9 |
| IR28025A/HHZ8-SAL9DT1-Y1 | 73.21 | 70.95 | 93 | 97.9 | 34 |
| IR28025A/HHZ5-SAL10-DT1-DT1 | 84.97 | 82.75 | 87.2 | 92.1 | 48.1 |
| IR28025A/HHZ5-SAL9-Y3-1 | 75.62 | 72.36 | 93.1 | 98 | 24.3 |
| IR28025A/IDSA77 | 60.46 | 68.9 | 89.9 | 94.8 | 31 |
| IR28025A/NERICA-L27 | 92.1 | 91.66 | 96 | 100.9 | 45.5 |
| IR28025A/NERICA-S-19 | 94 | 91.58 | 95.4 | 100.3 | 41.9 |
| IR28025A/R31785 | 88.67 | 88.63 | 101.3 | 106.2 | 44 |
| IR28025A/WITA9 | 94.96 | 94.4 | 110.4 | 115.3 | 52.5 |
| IR58025A/ARH47-4-2-1-2-1 | 90.6 | 89.1 | 103.5 | 108.4 | 36.5 |
| IR58025A/AD9246 | 91.4 | 87.6 | 98.6 | 103.5 | 64.6 |
| IR58025A/Giza 178 | 90.1 | 88.6 | 88.6 | 93.5 | 54.6 |
| IR58025A/Giza 179 | 89.7 | 87.9 | 97.8 | 102.7 | 50 |
| IR58025A/Giza 181 | 98.67 | 94.9 | 99.4 | 104.3 | 50.1 |
| IR58025A/Giza 182 | 95.2 | 91.4 | 101.4 | 106.3 | 58.4 |
| IR58025A/IR32307-10-3-2-1 | 98.3 | 97.07 | 90.9 | 95.8 | 45.9 |
| IR58025A/IR36 | 93.7 | 87.3 | 93.3 | 98.2 | 49.3 |
| IR58025A/IR64 | 84.3 | 87.2 | 89.7 | 94.6 | 38.7 |
| IR58025A/Kogoni | 93 | 87.2 | 96.2 | 91.1 | 36.2 |
| IR58025A/NERICA-L19 | 86.9 | 85.7 | 101.7 | 106.6 | 52.7 |
| IR58025A/NERICA-L19 | 94.6 | 91.8 | 98.8 | 90.7 | 51.8 |
| IR58025A/NERICA-S-44 | 95.62 | 92.33 | 94.9 | 90.8 | 55.2 |
| IR58025A/Sahel 108 | 86.4 | 86.9 | 88.9 | 93.8 | 53.9 |
| IR58025A/Sahel 134 | 89.6 | 89.8 | 82.8 | 87.7 | 54.8 |
| IR58025A/Sahel 159 | 90 | 85.9 | 97.9 | 102.8 | 54.9 |
| IR58025A/Sahel 328 | 87.8 | 87 | 90 | 94.9 | 51 |
| IR58025A/Sahel 329 | 97.1 | 96.1 | 99.1 | 104 | 47.1 |
| IR58025A/WAS127-12-1-2-1 | 91.6 | 86.16 | 100.5 | 105.4 | 36 |
| Sahel 134 (CK) | 98.5 | 97.33 | 86.5 | 94.51 | 39.9 |
| LSD0.05 | 3.2 | 2.9 | 9.4 | 8.6 | 5.6 |
| Coefficient of variation (%) | 6.8 | 3.4 | 8.8 | 7.7 | 11.1 |
Table 2 Testcross performance in a Sahel location of hybrids derived from crossing the popular cytoplasmic male sterility line IR58025A with new sources of restoring ability alleles, which were previously selected using a screening with flanking microsatellites.
| Cross | Pollen fertility | Spikelet fertility | Days to 50% | Plant height | Grain yield |
|---|---|---|---|---|---|
| (%) | (%) | flowering (d) | (cm) | per plant (g) | |
| IR58025A/ARH10-1-3-2-2-1 | 93.1 | 90.3 | 101.3 | 106.2 | 47.3 |
| IR58025A/ARH11-1-3-3-2-1 | 85.7 | 86.4 | 92.4 | 97.3 | 38.4 |
| IR58025A/ARH15-1-3-4-1-2 | 89.4 | 85.6 | 112.6 | 117.5 | 36.6 |
| IR58025A/ARH13-1-3-5-1-2 | 83.9 | 87.7 | 90.7 | 95.6 | 48.7 |
| IR58025A/ARH14-2-1-2-6-1 | 86.2 | 90.8 | 105.8 | 110.7 | 49.8 |
| IR58025A/ARH6-2-2-3-1-3 | 94.5 | 88.9 | 93.9 | 98.8 | 51.9 |
| IR58025A/ARH7-2-2-4-2-1 | 93.8 | 90 | 101 | 105.9 | 47 |
| IR58025A/ARH8-2-2-5-2-3 | 82.4 | 82.1 | 94.1 | 99 | 40.1 |
| IR58025A/ARH9-1-3-1-1-2 | 95 | 92.2 | 94.2 | 99.1 | 39.2 |
| IR28025A/ARH12-13-2-B-B-1-1 | 90.51 | 94.23 | 92.5 | 97.4 | 32.9 |
| IR28025A/ARH12-6-1-1-B-3-1 | 97.39 | 95.1 | 101.1 | 106 | 38.8 |
| IR28025A/ARH15-12-1-1-B-2-1 | 87.7 | 90.93 | 86.6 | 91.5 | 34.3 |
| IR28025A/ARH21-5-B-2-1 | 94.65 | 94.06 | 100.7 | 105.6 | 36.7 |
| IR28025A/ARH22-2-1-B-1-1 | 84.01 | 83.07 | 97.6 | 102.5 | 36.3 |
| IR28025A/ARH41-23-2-1-1-2 | 93.52 | 93.08 | 97.3 | 102.2 | 48.5 |
| IR28025A/ARH42-2-2-2-1-2 | 95.59 | 93.41 | 90.9 | 95.8 | 35.1 |
| IR28025A/ARH43-2-1-1-2 | 99.08 | 92.41 | 101.5 | 106.4 | 73.7 |
| IR28025A/ARH46-6-6-1-1 | 97 | 93.37 | 91.6 | 96.5 | 49.9 |
| IR28025A/HHZ8-SAL9DT1-Y1 | 73.21 | 70.95 | 93 | 97.9 | 34 |
| IR28025A/HHZ5-SAL10-DT1-DT1 | 84.97 | 82.75 | 87.2 | 92.1 | 48.1 |
| IR28025A/HHZ5-SAL9-Y3-1 | 75.62 | 72.36 | 93.1 | 98 | 24.3 |
| IR28025A/IDSA77 | 60.46 | 68.9 | 89.9 | 94.8 | 31 |
| IR28025A/NERICA-L27 | 92.1 | 91.66 | 96 | 100.9 | 45.5 |
| IR28025A/NERICA-S-19 | 94 | 91.58 | 95.4 | 100.3 | 41.9 |
| IR28025A/R31785 | 88.67 | 88.63 | 101.3 | 106.2 | 44 |
| IR28025A/WITA9 | 94.96 | 94.4 | 110.4 | 115.3 | 52.5 |
| IR58025A/ARH47-4-2-1-2-1 | 90.6 | 89.1 | 103.5 | 108.4 | 36.5 |
| IR58025A/AD9246 | 91.4 | 87.6 | 98.6 | 103.5 | 64.6 |
| IR58025A/Giza 178 | 90.1 | 88.6 | 88.6 | 93.5 | 54.6 |
| IR58025A/Giza 179 | 89.7 | 87.9 | 97.8 | 102.7 | 50 |
| IR58025A/Giza 181 | 98.67 | 94.9 | 99.4 | 104.3 | 50.1 |
| IR58025A/Giza 182 | 95.2 | 91.4 | 101.4 | 106.3 | 58.4 |
| IR58025A/IR32307-10-3-2-1 | 98.3 | 97.07 | 90.9 | 95.8 | 45.9 |
| IR58025A/IR36 | 93.7 | 87.3 | 93.3 | 98.2 | 49.3 |
| IR58025A/IR64 | 84.3 | 87.2 | 89.7 | 94.6 | 38.7 |
| IR58025A/Kogoni | 93 | 87.2 | 96.2 | 91.1 | 36.2 |
| IR58025A/NERICA-L19 | 86.9 | 85.7 | 101.7 | 106.6 | 52.7 |
| IR58025A/NERICA-L19 | 94.6 | 91.8 | 98.8 | 90.7 | 51.8 |
| IR58025A/NERICA-S-44 | 95.62 | 92.33 | 94.9 | 90.8 | 55.2 |
| IR58025A/Sahel 108 | 86.4 | 86.9 | 88.9 | 93.8 | 53.9 |
| IR58025A/Sahel 134 | 89.6 | 89.8 | 82.8 | 87.7 | 54.8 |
| IR58025A/Sahel 159 | 90 | 85.9 | 97.9 | 102.8 | 54.9 |
| IR58025A/Sahel 328 | 87.8 | 87 | 90 | 94.9 | 51 |
| IR58025A/Sahel 329 | 97.1 | 96.1 | 99.1 | 104 | 47.1 |
| IR58025A/WAS127-12-1-2-1 | 91.6 | 86.16 | 100.5 | 105.4 | 36 |
| Sahel 134 (CK) | 98.5 | 97.33 | 86.5 | 94.51 | 39.9 |
| LSD0.05 | 3.2 | 2.9 | 9.4 | 8.6 | 5.6 |
| Coefficient of variation (%) | 6.8 | 3.4 | 8.8 | 7.7 | 11.1 |
| Rf allele | SSR marker | Lines with positive allele | Percentage of lines with positive allele (%) | Selection accuracy (%) |
|---|---|---|---|---|
| Rf3 | RM443 | 123 | ########### | ########### |
| RM315 | 136 | ########### | ########### | |
| RM443 + RM315 | 90 | ########### | ########### | |
| Rf4 | RM171 | 110 | ########### | 59 |
| RM258 | 95 | ########### | 65 | |
| RM171 + RM258 | 65 | ########### | ########### | |
| Rf3+Rf4 | RM443 + RM315 + RM171 + RM258 | 45 | ########### | ########### |
Table 3 Efficiency of microsatellite (SSR) markers for selection of fertility restoration genes (Rf alleles).
| Rf allele | SSR marker | Lines with positive allele | Percentage of lines with positive allele (%) | Selection accuracy (%) |
|---|---|---|---|---|
| Rf3 | RM443 | 123 | ########### | ########### |
| RM315 | 136 | ########### | ########### | |
| RM443 + RM315 | 90 | ########### | ########### | |
| Rf4 | RM171 | 110 | ########### | 59 |
| RM258 | 95 | ########### | 65 | |
| RM171 + RM258 | 65 | ########### | ########### | |
| Rf3+Rf4 | RM443 + RM315 + RM171 + RM258 | 45 | ########### | ########### |
| [1] | Bazarkar L, Ali A J, Babaeian N A, Ebadi A A, Allahghollipour M, Kazemitabar K, Nematzadeh G.2008. Tagging four fertility restorer loci for wild abortive-cytoplasmic male sterility system in rice (Oryza sativa L.) using microsatellite markers.Euphytica, 164: 669-677. |
| [2] | Cao L Y, Zhan X D.2014. Chinese experiences in breeding three-line, two-line and super hybrid rice. In: Yan W G, Bao J S. Rice: Germplasm, Genetics and Improvement. Rijeka, Croatia: InTech: 279-308. |
| [3] | El-Namaky R A, Demont M.2013. Hybrid rice in Africa: Challenges and prospects. In: Wopereis M C S. Realizing Africa’s Rice Promise. Wallingford, the United Kingdom: CAB International: 173-178. |
| [4] | Hariprasanna K, Zaman F U, Singh A K.2006. Influence of male sterile cytoplasms on the physico-chemical grain quality traits in hybrid rice (Oryza sativa L.).Euphytica, 149: 273-280. |
| [5] | Hoan N T, Kinh N N, Bong B B, Tram N T, Qui T D, Bo N V.1998. Hybrid rice research and development in Vietnam. In: Virmani S S, Siddiq E A, Muralidharan K. Advances in Hybrid Rice Technology. Los Baños, the Philippines: International Rice Research Institute: 325-340. |
| [6] | IRRI.1996. Standard Evaluation System for Rice. 4th edn. Los Baños, the Philippines: International Rice Research Institute. |
| [7] | Julfiquar A W, Hasan M J, Azad A K, Hossain M A, Virmani S S.2003. Hybrid rice research and development in Bangladesh. In: Virmani S S, Siddiq E A, Muralidharan K. Advances in Hybrid Rice Technology. Los Baños, the Philippines: International Rice Research Institute: 235-245. |
| [8] | Li S Q, Yang G H, Li S B, Li Y S, Chen Z Y, Zhu Y G.2005. Distribution of fertility-restorer genes for wild-abortive CMS lines of rice in the AA genome species of genus Oryza.Ann Bot, 96: 461-466. |
| [9] | Li S Q, Yang D C, Zhu Y G.2007. Characterization and use of male sterility in hybrid rice breeding.J Integr Plant Biol, 49(6): 791-804. |
| [10] | Lu Z M, Hong D L.1999. Advances in hybrid rice seed production techniques. In: Basra A S. Heterosis and Hybrid Seed Production in Agronomic Crops. New York: Food Products Press: 65-79. |
| [11] | Mishra B, Viraktamath B C, Ahmed M I, Ramesha M S, Vijayakumar C H M.2003. Hybrid rice development and use in India. In: Virmani S S, Mao C X, Hardy B. Hybrid Rice for Food Security, Poverty Alleviation, and Environmental Protection. Los Baños, the Philippines: International Rice Research Institute: 265-286. |
| [12] | Murray M G, Thompson W F.1980. Rapid isolation of high molecular weight plant DNA.Nucl Acids Res, 8: 4321-4325. |
| [13] | Nematzadeh A, Kiani G.2010. Genetic analysis of fertility restoration genes for WA type cytoplasmic male sterility in Iranian restorer rice line DN-33-18.Afr J Biotech, 9: 6273-6277. |
| [14] | Redoña E D, Malabanan F M, Gaspar M G, de Leon J C, Sebastian L S.2003. Hybrid rice development and use in the Philippines. In: Virmani S S, Mao C X, Hardy B. Hybrid Rice for Food Security, Poverty Allevation, and Environmental Protection. Los Baños, the Philippines: International Rice Research Institute: 381-401. |
| [15] | Sattari M, Kathiresan A, Gregorio G B, Hernandez J E, Nas T M, Virmani S S.2007. Development and use of a two-gene marker-aided selection system for fertility restorer genes in rice.Euphytica, 153(1): 35-42. |
| [16] | Seck P A, Diagne A, Mohanty S, Wopereis M C S.2012. Crops that feed the world: 7. Rice.Food Sec, 4(1): 7-24. |
| [17] | Sheeba N K, Viraktamath B C, Sivaramakrishnan S, Gangashetti M G, Pawan K, Sundaram R M.2009. Validation of molecular markers linked to fertility restorer gene(s) for WA-CMS lines of rice.Euphytica, 167: 217-227. |
| [18] | Virmani S S.1998. Hybrid rice research and development in the tropics. In: Virmani S S, Siddiq E A, Muralidharan K. Advances in Hybrid Rice Technology. Los Baños, the Philippines: International Rice Research Institute: 35-49. |
| [19] | Yao F Y, Xu C G, Yu S B, Li J X, Gao Y J, Li X H, Zhang Q F.1997. Mapping and genetic analysis of two fertility restorer loci in the wild abortive cytoplasmic male sterility system of rice (Oryza sativa L.).Euphytica, 98: 183-187. |
| [20] | Yuan L P, Virmani S S.1988. Status of hybrid rice research and development. In: Hybrid Rice. Los Baños, the Philippines: International Rice Research Institute: 7-24. |
| [21] | Zhang G, Bharaj T S, Lu Y, Virmani S S, Huang N.1997. Mapping of the Rf-3 nuclear fertility-restoring gene for WA cytoplasmic male sterility in rice using RAPD and RFLP markers.Theor Appl Genet, 94(1): 27-33. |
| No related articles found! |
| 阅读次数 | ||||||
|
全文 |
|
|||||
|
摘要 |
|
|||||
