
Rice Science ›› 2016, Vol. 23 ›› Issue (1): 1-8.DOI: 10.1016/j.rsci.2016.01.001
• Orginal Article • Next Articles
Xia Xu, Xiao-bo Zhang, Yong-feng Shi, Hui-mei Wang, Bao-hua Feng, Xiao-hong Li, Qi-na Huang, Li-xin Song, Dan Guo, Yan He, Jian-li Wu(
)
Received:2015-05-12
Accepted:2015-07-06
Online:2016-01-20
Published:2015-11-05
Xia Xu, Xiao-bo Zhang, Yong-feng Shi, Hui-mei Wang, Bao-hua Feng, Xiao-hong Li, Qi-na Huang, Li-xin Song, Dan Guo, Yan He, Jian-li Wu. A Point Mutation in an F-Box Domain-Containing Protein Is Responsible for Brown Hull Phenotype in Rice[J]. Rice Science, 2016, 23(1): 1-8.
Add to citation manager EndNote|Ris|BibTeX
| Marker | Forward primer (5'→3') | Reverse primer (5'→3') |
| RM23804 | GAGCCGACTCAATCCAATCCTCTCC | ATCGTCTTCCAAGCAAGTGCAAGC |
| RM23893 | GGCGGCTTAAGAGTGTTTGTAGG | AGAGGATTGCTTTGCTGATGAGG |
| RM23904 | CTCACCGGAGCACCACTAACC | GAGAGCAAGACTGTGAAGTGTGAACC |
| RM7038 | GATTAGAGCTTTGGTGGTTCTTGG | ACTTGTGGTCGGTCTGGTAGTCC |
| InDel_6 | GAATCCGGTTCCGAGACTAAA | TCAATCTTGCAGCAAACAAGGC |
| InDel_10 | ACCTGATCGATGTCTAATTTGCAC | CGTTTACGAAAGGCAGAGGACA |
Table 1 Molecular markers used for gene mapping.
| Marker | Forward primer (5'→3') | Reverse primer (5'→3') |
| RM23804 | GAGCCGACTCAATCCAATCCTCTCC | ATCGTCTTCCAAGCAAGTGCAAGC |
| RM23893 | GGCGGCTTAAGAGTGTTTGTAGG | AGAGGATTGCTTTGCTGATGAGG |
| RM23904 | CTCACCGGAGCACCACTAACC | GAGAGCAAGACTGTGAAGTGTGAACC |
| RM7038 | GATTAGAGCTTTGGTGGTTCTTGG | ACTTGTGGTCGGTCTGGTAGTCC |
| InDel_6 | GAATCCGGTTCCGAGACTAAA | TCAATCTTGCAGCAAACAAGGC |
| InDel_10 | ACCTGATCGATGTCTAATTTGCAC | CGTTTACGAAAGGCAGAGGACA |
| Plant height | Panicle length | No. of productive panicles per plant | No. of filled grains | |
| (cm) | (cm) | per panicle | ||
| 120.0 ± 1.5 | 27.4 ± 0.3 | 15 ± 3 | 89 ± 12 | |
| 119.4 ± 1.4 | 26.1 ± 0.4* | 16 ± 2 | 81 ± 16 | |
| * and ** represent significant difference at the 0.05 and 0.01 levels, respectively. | ||||
Table 2 Performance of agronomic traits between wild type IR64 and mutant bh6.
| Plant height | Panicle length | No. of productive panicles per plant | No. of filled grains | |
| (cm) | (cm) | per panicle | ||
| 120.0 ± 1.5 | 27.4 ± 0.3 | 15 ± 3 | 89 ± 12 | |
| 119.4 ± 1.4 | 26.1 ± 0.4* | 16 ± 2 | 81 ± 16 | |
| * and ** represent significant difference at the 0.05 and 0.01 levels, respectively. | ||||
| Cross combination | F1 | F2 | P(3:1) | ||
| Total No. of plants | No. of wild type plants | No. of mutant type plants | |||
| bh6/CPSLO17 | Normal | 2 107 | 1 600 | 507 | 0.32 |
| bh6/IR64 | Normal | 684 | 507 | 177 | 0.6 |
Table 3 Genetic analysis of brown hull mutant bh6.
| Cross combination | F1 | F2 | P(3:1) | ||
| Total No. of plants | No. of wild type plants | No. of mutant type plants | |||
| bh6/CPSLO17 | Normal | 2 107 | 1 600 | 507 | 0.32 |
| bh6/IR64 | Normal | 684 | 507 | 177 | 0.6 |
| F3 line | Total No. of plants | No. of wild type plants | No. of mutant | P(3:1) |
| type plants | ||||
| Line 1 | 276 | 216 | 60 | 0.21 |
| Line 2 | 212 | 163 | 49 | 0.53 |
| Line 3 | 132 | 107 | 25 | 0.11 |
Table 4 Genetic analysis of F3 segregation lines derived from bh6/ IR64.
| F3 line | Total No. of plants | No. of wild type plants | No. of mutant | P(3:1) |
| type plants | ||||
| Line 1 | 276 | 216 | 60 | 0.21 |
| Line 2 | 212 | 163 | 49 | 0.53 |
| Line 3 | 132 | 107 | 25 | 0.11 |
Fig. 3. Fine mapping of the mutation on chromosome 9.A, bh6 is linked with SSR markers RM23804, RM23893, RM23904 and RM7038; B, bh6 is located in a 106 kb region between InDel_6 and InDel_10; C, Single base substitution at position 1013 (G1013A).
Fig. 4. Functional complementation of the mutation.A, Complementation construct p1300-9.3; B, Phenotype of IR64, bh6 and complementary transgenic line (c-bh6); C, Sequencing analysis of complementary transgenic lines. The arrow refers to the mutation site.
| [1] | Cui J J, Fan S C, Shao T, Huang Z J, Zheng D L, Tang D, Li M, Qian Q, Cheng Z K.2007. Characterization and fine mapping of the ibf mutant in rice.J Integr Plant Biol, 49(5): 678-685. |
| [2] | Debeaujon I, Peeters A J M, Leon-Kloosterziel K M, Koornneef M.2001. The TRANSPARENT TESTA12 gene of Arabidopsis encodes a multidrug secondary transporter-like protein required for flavonoid sequestration in vacuoles of the seed coat endothelium.Plant Cell, 13: 853-871. |
| [3] | Furukawa T, Maekawa M, Oki T, Suda I, Iida S, Shimada H, Takamure I, Kadowaki K.2007. The Rc and Rd genes are involved in proanthocyanidin synthesis in rice pericarp.Plant J, 49: 91-102. |
| [4] | Gu X Y, Kianian S F, Hareland G A, Hoffer B L, Foley M E.2005. Genetic analysis of adaptive syndromes interrelated with seed dormancy in weedy rice (Oryza sativa).Theor Appl Genet, 110: 1108-1118. |
| [5] | Han L, Wu X J, Zhang H Y, Jiang H, Li Y, Wang X D.2006. Study on the pigmentation of anthocyanidin in pericarp of black rice. Chin J Rice Sci, 20(4): 384-388. (in Chinese with English abstract) |
| [6] | Hong L L, Qian Q, Tang D, Wang K J, Li M, Cheng Z K.2012. A mutation in the rice chalcone isomerase gene causes the golden hull and internode 1 phenotype.Planta, 236: 141-151. |
| [7] | Iwata N, Omura T.1971. Linkage analysis by reciprocal translocation method in rice plants (Oryza sativa L.): II. Linkage groups corresponding to the chromosomes 5, 6, 8, 9, 10 and 11.Sci Bull Fac Agric Kyushu Univ, 25: 137-153. (in Japanese with English abstract) |
| [8] | Iwata N, Omura T.1977. Linkage studies in rice (Oryza sativa L.) on some mutants derived from chronic gamma irradiation. J Fac Agric Kyushu Univ, 21(2/3): 117-127. |
| [9] | Kinoshita T.1984. Current linkage maps.Rice Genet Newsl, 1: 16-27. |
| [10] | Lepiniec L, Debeaujon I, Routaboul J M, Baudry A, Pourcel L, Nesi N, Caboche M.2006. Genetics and biochemistry of seed flavonoids.Annu Rev Plant Biol, 57: 405-430. |
| [11] | Li L J, Zhou H P, Zhan X D, Chu Z L, Cheng S H, Cao L Y.2008. Genetic mapping of a gold hull and internode gene in rice (Oryza sativa).Chin J Rice Sci, 22(4): 432-434. (in Chinese with English abstract) |
| [12] | Li Q Y, Ye S H, Zhang Y Y, Ma X J, Mei J, Jin Q S, He Z H, Dong Y J, Zhang X M.2012. Molecular mapping of a gold hull and internode gene in Oryza sativa L.J Nucl Agric Sci, 26(7): 983-987. (in Chinese with English abstract) |
| [13] | Lu Y J, Zheng K L.1992. A simple method for isolation of rice DNA. Chin J Rice Sci, 6(1): 47-48. (in Chinese) |
| [14] | Maekawa M.1984. Geographical distribution of the genes for black hull coloration.Rice Genet Newsl, 1: 104-105. |
| [15] | Mirecki R M, Teramura A H.1984. Effects of ultraviolet-B irradiation on soybean: V. The dependence of plants sensitivity on the photosynthetic photon flux density during and after leaf expansion. Plant Physiol, 74: 475-480. |
| [16] | Nagao S.1951. Genie analysis and linkage relationship of characters in rice.Adv Genet, 4: 181-212. |
| [17] | Nagao S, Takahashi M.1963. Trail construction of twelve linkage groups in Japanese rice: Genetical studies on rice plant. J Fac Agric Hokkaido Univ, 53: 72-130. |
| [18] | Pourecl L, Rouraboul J M, Kerhoas L, Caboche M, Lepiniec L, Debeaujon I.2005. TRANSPARENT TESTA10 encodes a laccase- like enzyme involved in oxidative polymerization of flavonoids in Arabidopsis seed coat.Plant Cell, 17: 2966-2980. |
| [19] | Quattrocchio F, Verweij C W, Kroon A R, Spelt C E, Mol J N M, Koes R E.2006. PH4 of petunia is an R2R3 MYB protein that activates vacuolar acidification through interactions with basic- helix-loop-helix transcription factors of the anthocyanin pathway.Plant Cell, 18: 1274-1291. |
| [20] | Reddy A R.1996. Genetic and molecular analysis of the anthocyanin pigmentation pathway in rice. In: Khush G S. Rice Genetics: III. Proceedings of the Third International Rice Genetics Symposium, 16-20 October, 1995. Manila, the Philippines: International Rice Research Institute: 341-352. |
| [21] | Reddy V S, Dash S, Reddy A R.1995. Anthocyanin pathway in rice (Oryza sativa L.): Identification of a mutant showing dominantinhibition of anthocyanins in leaf and accumulation of proanthocyanidins in pericarp. Theor Appl Genet, 91(2): 301-312. |
| [22] | Saitoh K, Onishi K, Mikami I, Thidar K, Sano Y.2004. Allelic diversification at the C (OsC1) locus of wild and cultivated rice: Nucleotide changes associated with phenotypes.Genetics, 168: 997-1007. |
| [23] | Senda M, Jumonji A, Yumoto S, Ishikawa R, Harada T, Niizeki M, Akada S.2002. Analysis of the duplicated CHS1 gene related to the suppression of the seed coat pigmentation in yellow soybeans.Theor Appl Genet, 104: 1086-1091. |
| [24] | Shao T, Qian Q, Tang D, Chen J, Li M, Cheng Z K, Luo Q.2012. A novel gene IBF1 is required for the inhibition of brown pigment deposition in rice hull furrows.Theor Appl Genet, 125: 381-390. |
| [25] | Shirely B W.1996. Flavonoid biosynthesis: ‘New’ functions for an ‘old’ pathway. Trends Plant Sci, 1: 377-382. |
| [26] | Shi Y F, Chen J, Liu W Q, Huang Q N, Shen B, Hei L, Wu J L.2009. Genetic analysis and gene mapping of a new rolled-leaf mutant in rice (Oryza sativa L.).Sci China: Life Sci, 52(9): 885-890. |
| [27] | Takahashi M.1957. Analysis of apiculus color genes essential to anthocyanin coloration in rice. J Fac Agric Hokkaido Univ, 50: 266-362. |
| [28] | Wang F Q, Yang J, Fan F J, Wang J, Zhu J Y, Li W Q, Shen W B, Zhong W G.2014. Delayed inheritance of purple pericarp in rice and development of functional marker for Pb gene.Chin J Rice Sci, 28(6): 605-611. (in Chinese with English abstract) |
| [29] | Wu J L, Wu C J, Lei C L, Baraoidan M, Bordeos A, Madamba M R S, Ramos-Pamplona M, Mauleon R, Portugal A, Ulat V J, Bruskiewich R, Wang G L, Leach J, Khush G, Leung H.2005. Chemical and irradiation induced mutants of indica rice IR64 for forward and reverse genetics.Plant Mol Biol, 59: 85-97. |
| [30] | Zhang K W, Qian Q, Huang Z J, Wang Y Q, Li M, Hong L L, Zeng D L, Gu M H, Chu C C, Cheng Z K.2006. Gold hull and inter-node 2 encodes a primarily multifunctional cinnamyl-alcohol dehydrogenase in rice.Plant Physiol, 140(3): 972-983. |
| [31] | Zhu B F, Si L Z, Wang Z X, Zhou Y, Zhu J J, Shangguan Y Y, Lu D F, Fan D L, Li C Y, Lin H X, Qian Q, Sang T, Zhou B, Minobe Y, Han B.2011. Genetic control of a transition from black to straw-white seed hull in rice domestication.Plant Physiol, 155(3): 1301-1311. |
| [32] | Zhu Z G, Xiao H, Fu Y P, Hu G C, Yu Y H, Si H M, Zhang J L, Sun Z X.2001. Construction of transgenic rice populations by inserting the maize transposon Ac/Ds and genetic analysis for several mutants.Chin J Biotechnol, 17: 288-292. (in Chinese with English abstract) |
| No related articles found! |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||