Rapid Creation of New Photoperiod-/Thermo-Sensitive Genic Male-Sterile Rice Materials by CRISPR/Cas9 System

doi:10.1016/j.rsci.2018.12.006

Abstract

Abstract:

SUMMARY Rice is an important food crop in China and the development of hybrid rice is a crucial way to increase grain yield. The creation of dual-purpose nuclear-sterile lines for two-line hybrid breeding has become vital for commercial rice breeding. We constructed the pC1300-2x35S::Cas9-sgRNA^PTGMS2-1 expression vector for editing the male fertility gene PTGMS2-1 in two widely compatible rice varieties 93-11 and Huazhan by using the CRISPR/Cas9 system. We obtained the marker-free photoperiod-/thermo- sensitive genic male-sterile (P/TGMS) lines in T₁ generation. According to the experiments in phytotron with four temperature and photoperiod treatments we found the temperature is the main factor for restoring the pollen fertility of ptgms2-1 mutants in 93-11 and Huazhan and the photoperiod also has some effects on pollen fertility in two different rice backgrounds. The application of cultivating new male-sterile lines by genome editing system will significantly accelerate the rice breeding process.

Lan Shen, Guojun Dong, Yu Zhang, Guocheng Hu, Qiang Zhang, Guanglian Hu, Bo Xu, Deyong Ren, Jiang Hu, Li Zhu, Zhenyu Gao, Guangheng Zhang, Longbiao Guo, Dali Zeng, Qian Qian. Rapid Creation of New Photoperiod-/Thermo-Sensitive Genic Male-Sterile Rice Materials by CRISPR/Cas9 System[J]. Rice Science, 2019, 26(2): 129-132.

Figures/Tables 7

Fig. 1 Schematic diagram of the targeted sites in PTGMS2-1 (A), flow diagram of CRISPR/Cas9 system for editing PTGMS2-1 (B), and mutation types at the PTGMS2-1 loci of Huazhan and 93-11 in the T0 generation (C).The numbers of nucleotide at both sides of the target sequences are 18 bp. Black arrows represent the detection primers. The targeted sequence is highlighted in blue, while the protospacer adjacent motif (PAM) sequence is underlined. Mutations of 1 bp insertions are in red lowercase letters. The deleted sequences are shown by blue hyphens.

Fig. 2 Pollen fertility of wild type (WT) and ptgms2-1 in 93-11 and Huazhan.A–H, I2-KI staining of pollen grains of WT and ptgms2-1 in 93-11. Scale bars are 200 μm. I–P, I2-KI staining of pollen grains of WT and ptgms2-1 in Huazhan. Scale bars are 200 μm.

Supplemental Table 1 Primers used in this research.

Primer name	Sequence (5′-3′)	Experiment
PTGMS-g++	GGCAACCTCGTCCCCCTCGAGAT	Vector construction
PTGMS-g--	AAACATCTCGAGGGGGACGAGGT
T3	ATTAACCCTCACTAAAGGGA
PTGMS-JC-F	GTCTCGCAGGAGTTCCTCTT	Detection of target mutations
PTGMS-JC-R	GAGGCCAAGATACTCTGGCT	Detection of target mutations
Hyg-F	AAGACCAATGCGGAGCATATAC	PCR-based genotyping of the T-DNA construct
Hyg-R	GTGATATCTCCACTGACGTA
Cas9-F	ACCAGACACGAGACGACTAA
pC1300-R	ATCGGTGCGGGCCTCTTC
Actin-F	TGCTATGTACGTCGCCATCCA
Actin-R	AATGAGTAACCACGCTCCGTC

Fig. 1 Comparison of plant height and tiller number of 93-11 and Huazhan with the mutants in T1 generation.A, Plant morphology of 93-11 and ptgms2-1. Scale bar, 10 cm. B, Comparison of plant height between 93-11 and ptgms2-1. C, Comparison of tiller number between 93-11 and ptgms2-1. D, Plant morphology of Huazhan and the ptgms2-1. Scale bar, 10 cm. E, Comparison of plant height between Huazhan and ptgms2-1. F, Comparison of tiller number between Huazhan and ptgms2-1. The significant differences were examined using a Student’s t-test (*, P < 0.05; **, P < 0.01; n ≥ 5).

Fig. 2 Comparison of panicle-related traits of 93-11 and Huazhan with the mutants in T1 generation.A–B, Panicle morphology of 93-11 and Huazhan. Scale bar, 1 cm. C and G, Comparison of grain number between wild type and ptgms2-1 of 93-11 and Huazhan. D and H, Comparison of panicle length between wild type and ptgms2-1 of 93-11 and Huazhan. E and I, Comparison of primary branch number between wild type and ptgms2-1 of 93-11 and Huazhan. F and J, Comparison of secondary branch number between wild type and ptgms2-1 of 93-11 and Huazhan. The differences in C to J were examined using a Student’s t-test (*, P < 0.05; **, P < 0.01; n ≥ 5).

Fig. 3 PCR identification of the marker-free transgenic plants in T1 generation.A, PCR identification of the marker-free transgenic plants in T1 generation in 93-11. B, PCR identification of the marker-free transgenic plants in T1 generation in Huazhan. 1-20, T1 transgenic lines. +, Positive control of transgenic line. WT and H2O, Negative control. Actin, a gene was used as control.

Fig. 4 Morphology of WT and ptgms2-1 in 9311 and Huazhan.A, Mature florets of 9311 and ptgms2-1 plants. Scale bars = 2 mm. B, Anther of 9311 and ptgms2-1 plants. Scale bars = 2 mm. C, Mature florets of Huazhan and ptgms2-1 plants. Scale bars = 2 mm. D, Anther of Huazhan and ptgms2-1 plants. Scale bars = 2 mm.

References 13

[1]	Chang Z Y, Chen Z F, Wang N, Xie G, Lu J W, Yan W, Zhou J L, Tang X Y, Deng X W.2016. Construction of a male sterility system for hybrid rice breeding and seed production using a nuclear male sterility gene.Proc Natl Acad Sci USA, 113(49): 14145-14150.
[2]	Cheng S H, Zhuang J Y, Fan Y Y, Du J H, Cao L Y.2007. Progress in research and development on hybrid rice: A super-domesticate in China.Ann Bot, 100(5): 959-966.
[3]	Fan Y R, Yang J Y, Mathioni S M, Yu J S, Shen J Q, Yang X F, Wang L, Zhang Q H, Cai Z X, Xu C G, Li X H, Xiao J H, Meyers B C, Zhang Q F.2016. PMS1T, producing phased small- interfering RNAs, regulates photoperiod-sensitive male sterility in rice.Proc Natl Acad Sci USA, 113(52): 15144-15149.
[4]	Jiang J H, Ni J L, Wu S, Wang D Z.2017. Development of permanent genic male sterile line by pyramiding thermo-sensitive genic male sterile genes and reverse temperature induced genic male sterile genes in rice (Oryza sativa L.). Chin J Rice Sci, 31(4): 371-378. (in Chinese with English abstract)
[5]	Peng S, Cassman K G, Virmani S S, Sheehy J, Khush G S.1999. Yield potential trends of tropical rice since the release of IR8 and the challenge of increasing rice yield potential.Crop Sci, 39(6): 1552-1559.
[6]	Ren D Y, Hu J, Xu Q K, Cui Y J, Zhang Y, Zhou T T, Rao Y C, Xue D W, Zeng D L, Zhang G H, Gao Z Y, Zhu L, Shen L, Chen G, Guo L B, Qian Q.2018. FZP determines grain size and sterile lemma fate in rice.J Exp Bot, 69(20): 4853-4866.
[7]	Shen L, Wang C, Fu Y P, Wang J J, Liu Q, Zhang X M, Yan C J, Qian Q, Wang K J.2018. QTL editing confers opposing yield performance in different rice varieties.J Integr Plant Biol, 60(2): 89-93.
[8]	Tang L, Mao B G, Li Y K, Lv Q M, Zhang L P, Chen C Y, He H J, Wang W P, Zeng X F, Shao Y, Pan Y L, Hu Y Y, Peng Y, Fu X Q, Li H Q, Xia S T, Zhao B R.2017. Knockout of OsNramp5 using the CRISPR/Cas9 system produces low Cd-accumulating indica rice without compromising yield. Sci Rep, 7(1): 14438.
[9]	Xu J J, Wang B H, Wu Y H, Du P N, Wang J, Wang M, Yi C D, Gu M H, Liang G H.2011. Fine mapping and candidate gene analysis of ptgms2-1, the photoperiod-thermo-sensitive genic male sterile gene in rice(Oryza sativa L.). Theor Appl Genet, 122(2): 365-372.
[10]	Zhang J S, Zhang H, Botella J R, Zhu J K.2018. Generation of new glutinous rice by CRISPR/Cas9-targeted mutagenesis of the Waxy gene in elite rice varieties. J Integr Plant Biol, 60(5): 369-375.
[11]	Zhou H, Liu Q J, Li J, Jiang D G, Zhou L Y, Wu P, Lu S, Li F, Zhu L Y, Liu Z L, Chen L T, Liu Y G, Zhuang C X.2012. Photoperiod- and thermo-sensitive genic male sterility in rice are caused by a point mutation in a novel noncoding RNA that produces a small RNA.Cell Res, 22(4): 649-660.
[12]	Zhou H, Zhou M, Yang Y Z, Li J, Zhu L Y, Jiang D G, Dong J F, Liu Q J, Gu L F, Zhou L Y, Feng M J, Qin P, Hu X C, Song C L, Shi J F, Song X W, Ni E D, Wu X J, Deng Q Y, Liu Z L, Chen M S, Liu Y G, Cao X F, Zhuang C X.2014. RNase ZS1 processes UbL40 mRNAs and controls thermosensitive genic male sterility in rice.Nat Commun, 5: 4884.
[13]	Zhou H, He M, Li J, Chen L, Huang Z F, Zheng S Y, Zhu L Y, Ni E D, Jiang D G, Zhao B R, Zhuang C X.2016. Development of commercial thermo-sensitive genic male sterile rice accelerates hybrid rice breeding using the CRISPR/Cas9-mediatedTMS5 editing system. Sci Rep, 6: 37395.