Rice Science ›› 2020, Vol. 27 ›› Issue (2): 124-132.DOI: 10.1016/j.rsci.2020.01.003
• Research Paper • Previous Articles Next Articles
Pandit Elssa1, Kumar Panda Rajendra2, Sahoo Auromeera1, Ranjan Pani Dipti3, Kumar Pradhan Sharat1()
Received:
2018-09-25
Accepted:
2018-12-22
Online:
2020-03-28
Published:
2019-11-28
About author:
#These authors contributed equally to this work
Pandit Elssa, Kumar Panda Rajendra, Sahoo Auromeera, Ranjan Pani Dipti, Kumar Pradhan Sharat. Genetic Relationship and Structure Analysis of Root Growth Angle for Improvement of Drought Avoidance in Early and Mid-Early Maturing Rice Genotypes[J]. Rice Science, 2020, 27(2): 124-132.
Add to citation manager EndNote|Ris|BibTeX
No. | Accession | Origin/place of adaption | Leaf rolling | Leaf drying | Spikelet fertility (%) | Single plant yield (g) |
---|---|---|---|---|---|---|
1 | ARC12071 | Assam, India | 3 (89.25) | 3 (84.25) | 63.0218 | 10.55 |
2 | Ac 10984 | India | 1 (94.25) | 1 (89.25) | 81.8218 | 11.57 |
3 | Ac 39800 | India | 3 (94.25) | 3 (89.25) | 63.8218 | 10.15 |
4 | NSIC Rc 106 | IRRI, Philippines | 7 (84.25) | 7 (79.25) | 15.8818 | 4.255 |
5 | Ac 39739 | India | 3 (89.25) | 3 (85.25) | 65.1218 | 9.245 |
6 | HONGZUI EL | IRRI, Philippines | 7 (89.25) | 5 (84.25) | 28.271875 | 6.235 |
7 | Ac 39804 | India | 3 (94.25) | 3 (89.25) | 61.321875 | 10.335 |
8 | Ac 10914 | India | 1 (95.25) | 1 (89.25) | 83.121875 | 12.305 |
9 | Ac 39770 | India | 3 (92.25) | 3 (89.25) | 61.821875 | 9.835 |
10 | BENAMURI | Odisha, India | 5 (79.25) | 3 (79.25) | 43.071875 | 7.525 |
11 | Ac 39737 | India | 3 (84.25) | 3 (84.25) | 65.121875 | 10.345 |
12 | Ac 39955 | India | 3 (94.25) | 3 (89.25) | 62.021875 | 9.935 |
13 | Ac 39843 | India | 1 (97.25) | 1 (94.25) | 74.321875 | 12.355 |
14 | SATHI | Utter Pradesh, India | 5 (74.25) | 3 (79.25) | 46.221875 | 8.355 |
15 | Ac 39769 | India | 3 (84.25) | 3 (87.25) | 45.321875 | 9.555 |
16 | Ac 39933 | India | 3 (87.25) | 3 (89.25) | 49.921875 | 10.975 |
17 | Ac 39794 | India | 3 (89.25) | 3 (91.25) | 48.921875 | 10.535 |
18 | DZ78 | IRRI, Philippines | 5 (79.25) | 5 (84.25) | 33.121875 | 6.775 |
19 | Ac39827 | India | 5 (74.25) | 5 (79.25) | 42.721875 | 6.615 |
20 | Ac 39928 | India | 5 (84.25) | 5 (79.25) | 30.121875 | 5.475 |
21 | Ac 39823 | India | 5 (89.25) | 5 (84.25) | 29.221875 | 5.675 |
22 | SUDUWEE | IRRI, Philippines | 5 (89.25) | 3 (74.25) | 41.871875 | 7.245 |
23 | Ac 39871 | India | 3 (94.25) | 3 (91.25) | 49.321875 | 10.355 |
24 | Ac 39781 | India | 3 (97.25) | 3 (94.25) | 61.921875 | 9.565 |
25 | Ac 39773 | India | 3 (91.25) | 3 (89.25) | 49.521875 | 9.585 |
26 | KHAODAW | Thailand | 5 (89.25) | 3 (87.25) | 38.121875 | 7.115 |
27 | Ac 39795 | India | 3 (91.25) | 3 (89.25) | 61.321875 | 8.975 |
28 | Ac 39776 | India | 5 (89.25) | 5 (84.25) | 33.921875 | 6.375 |
29 | EZI | China | 5 (95.25) | 5 (91.25) | 33.121875 | 5.255 |
30 | Ac 39910 | India | 5 (91.25) | 5 (89.25) | 38.421875 | 6.645 |
31 | Ac 10931 | India | 3 (94.25) | 3 (91.25) | 58.821875 | 9.645 |
32 | MADHABSA | Bangadesh | 5 (84.25) | 5 (79.25) | 33.741875 | 6.225 |
33 | Ac 39749 | India | 3 (94.25) | 3 (91.25) | 65.321875 | 10.355 |
34 | Ac 39792 | India | 7 (97.25) | 7 (96.25) | 6.121875 | 4.205 |
35 | ARC 10319 | Assam, India | 5 (89.25) | 3 (89.25) | 36.021875 | 7.845 |
36 | Ac 10981 | India | 5 (91.25) | 5 (89.25) | 19.921875 | 5.975 |
37 | Ac 39755 | India | 5 (84.25) | 5 (79.25) | 20.121875 | 6.475 |
38 | Ac 39733 | India | 3 (89.25) | 3 (87.25) | 61.421875 | 10.575 |
39 | Ac 39760 | India | 3 (91.25) | 3 (89.25) | 46.621875 | 10.115 |
40 | Ac 10939 | India | 3 (93.25) | 3 (89.25) | 63.321875 | 10.535 |
41 | ARC10818 | Assam, India | 7 (94.25) | 7 (91.25) | 21.841875 | 4.515 |
42 | Ac 11206 | India | 7 (95.25) | 5 (87.25) | 6.421875 | 5.575 |
43 | Ac 39834 | India | 5 (74.25) | 5 (79.25) | 20.021875 | 6.645 |
44 | AL LANKE | - | 5 (80) | 5 (81.5) | 30.821875 | 5.07 |
45 | Ac 10816 | India | 3 (78) | 3 (79.5) | 61.721875 | 9.97 |
46 | Ac 11209 | India | 7 (85) | 5 (79.5) | 6.921875 | 4.87 |
47 | HARBHOOND | Madhya Pradesh, India | 3 (85) | 3 (86.5) | 40.921875 | 8.95 |
48 | Ac 10820 | India | 3 (90) | 3 (91.5) | 63.221875 | 9.07 |
49 | Ac 11261 | India | 1 (98) | 1 (94.5) | 81.921875 | 12.54 |
50 | HAWSHAO | IRRI, Philippines | 5 (75) | 5 (77.5) | 23.921875 | 5.52 |
51 | Ac 10995 | India | 3 (80) | 3 (81.5) | 47.321875 | 9.63 |
52 | Ac 10914 | India | 7 (98) | 7 (94.5) | 17.221875 | 5.05 |
53 | RAY JAZAYKAYZ | IRRI, Philippines | 3 (88) | 3 (84.5) | 47.521875 | 8.51 |
54 | Ac 10837 | India | 5 (70) | 3 (64.5) | 38.621875 | 6.64 |
55 | Ac 11087 | India | 7 (95) | 7 (94.5) | 7.521875 | 4.62 |
56 | AUS 439 | Assam, India | 5 (82) | 5 (79.5) | 29.921875 | 5.87 |
57 | Ac 10843 | India | 5 (65) | 3 (69.5) | 40.821875 | 5.51 |
58 | Ac 10840 | India | 5 (75) | 3 (69.5) | 42.121875 | 5.71 |
59 | Ac 11074 | India | 7 (95) | 7 (91.5) | 19.221875 | 4.95 |
60 | RR 272-17- | Jharkhand, India | 5 (92) | 5 (89.5) | 27.921875 | 5.28 |
61 | Ac 10990 | India | 5 (85) | 5 (81.5) | 37.321875 | 7.24 |
62 | Ac 11462 | India | 3 (85) | 3 (84.5) | 58.321875 | 7.05 |
63 | RAB-56-50 | Africa | 5 (90) | 3 (87.5) | 31.921875 | 6.74 |
64 | Ac 10956 | India | 5 (92) | 5 (89.5) | 39.821875 | 5.02 |
65 | Ac 10811 | India | 7 (75) | 5 (71.5) | 16.821875 | 6.04 |
66 | Ac 10875 | India | 5 (78) | 3 (74.5) | 40.921875 | 5.97 |
67 | Heera | Odisha, India | 5 (72) | 3 (77.5) | 40.521875 | 7.08 |
68 | Ac 11069 | India | 1 (95) | 3 (84.5) | 67.421875 | 9.07 |
69 | Ac 10965 | India | 3 (90) | 3 (87.5) | 63.721875 | 8.08 |
70 | Ac 10857 | India | 3 (92) | 3 (89.5) | 46.521875 | 9.27 |
71 | DASARAMATIA | India | 5 (78) | 3 (74.5) | 41.521875 | 7.28 |
72 | Ac 39911 | India | 5 (80) | 3 (74.5) | 33.821875 | 6.94 |
73 | Ac 39750 | India | 7 (80) | 5 (77.5) | 16.821875 | 6.04 |
74 | Ac 39957 | India | 3 (85) | 3 (84.5) | 63.121875 | 8.74 |
75 | JALIA | India | 5 (78) | 3 (74.5) | 35.821875 | 7.49 |
76 | Ac 10862 | India | 5 (68) | 3 (69.5) | 42.521875 | 6.37 |
77 | Ac 10915 | India | 3 (85) | 3 (84.5) | 36.121875 | 8.75 |
78 | Ac 39870 | India | 3 (88) | 3 (84.5) | 37.121875 | 8.54 |
79 | HASURIDHAN | India | 5 (90) | 5 (84.5) | 30.921875 | 5.93 |
80 | Ac 10994 | India | 7 (95) | 5 (79.5) | 17.521875 | 5.72 |
81 | Ac 10984 | India | 3 (93) | 3 (89.5) | 45.621875 | 9.61 |
82 | CR143-2-2 | NRRI, Cuttack, India | 1 (98) | 1 (94.5) | 70.621875 | 12.65 |
83 | Ac 10954 | India | 7 (75) | 5 (69.5) | 18.021875 | 4.6 |
84 | Ac 39840 | India | 3 (85) | 3 (84.5) | 58.321875 | 9.05 |
85 | SADABAHAR | Jharkhand, India | 5 (80) | 3 (74.5) | 36.821875 | 6.99 |
86 | Ac 10958 | India | 3 (90) | 3 (87.5) | 60.621875 | 9.6 |
87 | Ac 10925 | India | 7 (92.25) | 7 (92) | 16.771875 | 4.775 |
88 | RR347-1 | Jharkhand, India | 5 (82.25) | 3 (80) | 41.171875 | 7.315 |
89 | Ac 10976 | India | 1 (96.25) | 1 (94) | 65.471875 | 12.765 |
90 | Ac 11085 | India | 5 (85.25) | 3 (80) | 36.871875 | 6.465 |
91 | Ac 10957 | India | 5 (85.25) | 3 (85) | 34.971875 | 5.665 |
92 | LALANKANDA-41 | India | 1 (98.25) | 1 (95) | 69.471875 | 11.465 |
93 | Ac 11433 | India | 3 (92.25) | 3 (90) | 61.271875 | 9.445 |
94 | Ac 39975 | India | 3 (80.25) | 1 (85) | 64.671875 | 8.765 |
95 | Ac 11280 | India | 3 (85.25) | 3 (85) | 61.771875 | 8.675 |
96 | Ac 11217 | India | 3 (90.25) | 3 (90) | 63.171875 | 9.865 |
97 | RR-2-6 | Jharkhand, India | 3 (85.25) | 3 (90) | 51.571875 | 10.775 |
98 | Ac 11114 | India | 7 (85.25) | 5 (80) | 15.471875 | 5.665 |
99 | Ac 11328 | India | 5 (80.25) | 3 (78) | 38.071875 | 6.795 |
100 | JOGESH | Jharkhand, India | 3 (92.25) | 3 (92) | 45.571875 | 9.575 |
101 | Ac 11030 | India | 3 (90.25) | 3 (90) | 43.071875 | 8.965 |
102 | Ac 10925 | India | 1 (95.25) | 1 (95) | 65.871875 | 12.665 |
103 | Dinorado | Philippines | 1 (96.25) | 1 (96) | 62.371875 | 13.415 |
104 | Ac 11007 | India | 3 (90.25) | 3 (92) | 46.671875 | 9.435 |
105 | Ac 39890 | India | 1 (98.25) | 1 (95) | 82.071875 | 11.735 |
106 | Ac 11258 | India | 3 (65.25) | 3 (70) | 61.771875 | 9.335 |
107 | RR-348-6 | Jharkhand, India | 5 (70.25) | 3 (80) | 39.771875 | 8.735 |
108 | Ac 11265 | India | 3 (80.25) | 3 (90) | 55.071875 | 9.455 |
109 | Ac 11205 | India | 3 (85.25) | 3 (80) | 46.471875 | 9.275 |
110 | RR-665-645 | Jharkhand, India | 5 (75.25) | 3 (70) | 37.171875 | 8.625 |
111 | Ac 11333 | India | 3 (70.25) | 3 (75) | 38.871875 | 8.665 |
112 | Ac 11246 | India | 3 (88.25) | 3 (85) | 36.971875 | 8.765 |
113 | VANAPRABHA | Odisha, India | 5 (78.25) | 3 (75) | 35.571875 | 7.665 |
114 | Ac 11311 | India | 3 (90.25) | 1 (88) | 63.571875 | 9.535 |
115 | Ac 11057 | India | 3 (95.25) | 3 (90) | 47.271875 | 8.775 |
116 | RR20 | Jharkhand, India | 5 (90.25) | 5 (90) | 32.371875 | 5.845 |
117 | Ac 11464 | India | 3 (85.25) | 3 (80) | 48.371875 | 8.965 |
118 | RR160-10 | Jharkhand, India | 7 (98.25) | 7 (98) | 17.231875 | 4.445 |
119 | RR 51-1 | Jharkhand, India | 3 (95.25) | 3 (95) | 52.271875 | 10.535 |
120 | RR 347-466 | Jharkhand, India | 7 (98.25) | 7 (98) | 16.291875 | 4.735 |
121 | Ac 39963 | India | 3 (92.25) | 3 (92) | 63.171875 | 8.195 |
122 | KHANDAGIRI | Odisha, India | 3 (95.25) | 3 (95) | 54.271875 | 10.575 |
123 | Ac 39753 | India | 7 (75.25) | 5 (70) | 19.871875 | 5.875 |
124 | Ac 39839 | India | 3 (90.25) | 3 (95) | 48.871875 | 9.665 |
125 | BLACKGORA | Jharkhand, India | 3 (80.25) | 3 (90) | 51.571875 | 11.575 |
126 | Ac 39762 | India | 7 (75.25) | 5 (80) | 19.471875 | 4.865 |
127 | RR354-1 | Jharkhand, India | 3 (90.25) | 3 (88) | 52.271875 | 11.565 |
128 | RR 272-1745 | Jharkhand, India | 3 (92.25) | 3 (90) | 54.571875 | 11.575 |
129 | Ac 39973 | India | 1 (96.25) | 1 (95) | 82.371875 | 12.855 |
130 | Ac 10374 | India | 7 (83.5) | 5 (79) | 18.946875 | 5.7525 |
131 | SATYABHAMA | Odisha, India | 3 (93.5) | 3 (89) | 63.146875 | 14.2625 |
132 | Ac 39797 | India | 3 (86.5) | 3 (84) | 63.446875 | 9.5325 |
133 | Ac 10978 | India | 7 (78.5) | 3 (74) | 18.146875 | 5.2025 |
134 | PYARI | Odisha, India | 3 (93.5) | 3 (74) | 51.946875 | 11.5625 |
135 | Ac 10964 | India | 3 (88.5) | 3 (91) | 56.246875 | 8.4225 |
136 | Ac 10972 | India | 3 (93.5) | 3 (89) | 62.146875 | 10.0025 |
137 | CR DHAN204 | NRRI, Cuttack, India | 5 (73.5) | 3 (69) | 46.546875 | 9.7325 |
138 | Ac 10899 | India | 7 (93.5) | 7 (94) | 19.046875 | 3.8625 |
139 | Ac 39759 | India | 7 (88.5) | 5 (79) | 19.546875 | 5.1225 |
140 | Ac 39893 | India | 3 (93.5) | 3 (94) | 63.246875 | 8.5325 |
141 | CR DHAN 202 | NRRI, Cuttack, India | 3 (90.5) | 3 (89) | 62.546875 | 13.1425 |
142 | Ac 10972 | India | 5 (73.5) | 3 (69) | 28.846875 | 6.3325 |
143 | Ac 11152 | India | 3 (78.5) | 3 (84) | 63.946875 | 9.7625 |
144 | Ac 11322 | India | 3 (83.5) | 1 (89) | 63.146875 | 8.1325 |
145 | CR DHAN 201 | NRRI, Cuttack, India | 5 (78.5) | 3 (89) | 52.946875 | 9.3625 |
146 | Ac 10994 | India | 3 (83.5) | 1 (79) | 63.546875 | 7.8625 |
147 | Ac 39790 | India | 1 (92.5) | 1 (89) | 81.346875 | 11.5625 |
148 | Ac 10993 | India | 5 (82.5) | 3 (81) | 29.346875 | 5.4325 |
149 | KALCHI | India | 5 (84.5) | 5 (79) | 23.446875 | 5.0925 |
150 | Ac 11202 | India | 5 (88.5) | 3 (84) | 28.746875 | 4.5625 |
151 | Ac 11208 | India | 5 (83.5) | 3 (81) | 26.646875 | 5.6625 |
152 | Ac 10957 | India | 3 (90.5) | 3 (89) | 63.246875 | 9.2125 |
153 | SETKA | India | 5 (63.5) | 5 (74) | 21.646875 | 5.0925 |
154 | IR10C-137 | IRRI, Philippines | 3 (83.5) | 1 (89) | 64.546875 | 8.3325 |
155 | IR10C-167 | IRRI, Philippines | 1 (83.5) | 1 (79) | 80.946875 | 10.2325 |
156 | IR10C-136 | IRRI, Philippines | 3 (78.5) | 1 (84) | 65.246875 | 7.8625 |
157 | CHINGERDHAN | India | 3 (88.5) | 3 (89) | 54.946875 | 9.3625 |
158 | IR83142-B-36-B | IRRI, Philippines | 3 (83.5) | 1 (79) | 61.646875 | 8.5625 |
159 | IR10C-108 | IRRI, Philippines | 3 (78.5) | 1 (89) | 63.546875 | 11.3325 |
160 | BUNDEI | India | 3 (73.5) | 3 (74) | 52.446875 | 10.4425 |
161 | IR10C-161 | IRRI, Philippines | 1 (93.5) | 1 (89) | 66.446875 | 13.4625 |
162 | SHELLA | India | 5 (68.5) | 3 (79) | 36.746875 | 8.4425 |
163 | CR Dhan 301 | NRRI, Cuttack | 7 (88.5) | 7 (89) | 17.946875 | 3.4425 |
164 | IR10C-110 | IRRI, Philippines | 3 (83.5) | 1 (89) | 62.246875 | 10.7325 |
165 | DHOBOSANKARI | India | 3 (80.5) | 3 (81) | 45.946875 | 9.6425 |
166 | CR Dhan 303 | NRRI, Cuttack, India | 7 (92.5) | 7 (93) | 18.546875 | 3.5025 |
167 | IR10C-179 | IRRI, Philippines | 3 (73.5) | 1 (79) | 63.046875 | 11.5325 |
168 | CR Dhan 304 | NRRI, Cuttack, India | 7 (88.5) | 7 (89) | 18.466875 | 3.1325 |
169 | IR10C-103 | IRRI, Philippines | 3 (73.5) | 1(79) | 64.746875 | 12.2325 |
170 | KARNI | India | 1 (96.5) | 1 (97) | 63.146875 | 12.1825 |
171 | CR Dhan 305 | NRRI, Cuttack, India | 5 (80.5) | 5 (79) | 27.546875 | 6.4625 |
172 | IR10C-126 | IRRI, Philippines | 3 (83.5) | 1 (79) | 62.446875 | 10.5325 |
173 | DENGBOREI | Eastern India | 3 (80.25) | 3 (75) | 52.046875 | 10.865 |
174 | IR10G-103 | IRRI, Philippines | 1 (85.25) | 1 (80) | 65.846875 | 13.885 |
175 | CR Dhan 306 | NRRI, Cuttack, India | 7 (90.25) | 7 (90) | 15.946875 | 3.215 |
176 | SEKRE | EasternIndia | 7 (85.25) | 7 (85) | 18.146875 | 3.345 |
177 | Maudamani | NRRI, Cuttack, India | 7 (98.25) | 7 (98) | 15.146875 | 3.585 |
178 | CR Dhan 309 | NRRI, Cuttack, India | 7 (98.25) | 7 (95) | 17.746875 | 4.685 |
179 | CR Dhan 205 | NRRI, Cuttack, India | 5 (85.25) | 3 (75) | 43.046875 | 8.925 |
180 | TAWADHAN | Northern India | 5 (75.25) | 3 ( 70) | 40.246875 | 8.715 |
181 | IR83141-B-32-B | IRRI, Philippines | 3 (85.25) | 1 (80) | 63.746875 | 13.625 |
182 | IR64197-3B-15-2 | IRRI, Philippines | 3 (85.25) | 1 (85) | 63.946875 | 13.295 |
183 | CR Dhan 206 | NRRI, Cuttack, India | 5 (92.25) | 5 (90) | 33.346875 | 7.985 |
184 | KUTIARASI | India | 3 (95.25) | 3 (92) | 60.746875 | 12.915 |
185 | CR Dhan 207 | NRRI, Cuttack, India | 5 (85.25) | 3 (65) | 38.146875 | 8.715 |
186 | SEKRADHAN | India | 3 (85.25) | 3 (85) | 56.046875 | 10.715 |
187 | IR10C-157 | IRRI, Philippines | 3 (90.25) | 3 (88) | 60.846875 | 5.745 |
188 | GURUJIDHAN | India | 7 (80.25) | 5 (80) | 28.346875 | 9.925 |
189 | Lalat | Odisha, India | 7 (85.25) | 5 (85) | 26.746875 | 5.745 |
190 | KASALATH | Bangladesh | 3 (80.25) | 3 (80) | 60.446875 | 10.425 |
191 | Satyakrishna | Odisha, India | 7 (90.25) | 5 (80) | 16.146875 | 4.745 |
192 | Sahabhagi Dhan | Odisha, india | 1 (95.25) | 1 (90) | 65.846875 | 14.425 |
193 | Satabdi | West Bengal, India | 7 (95.25) | 7 (95) | 18.346875 | 3.085 |
194 | KUSUMA | Odisha, India | 3 (90.25) | 3 (90) | 46.146875 | 9.925 |
195 | Annapurna | Odisha, India | 5 (80.25) | 5 (80) | 22.846875 | 5.425 |
196 | Surendra | Odisha, India | 5 (85.25) | 5 (82) | 24.346875 | 4.945 |
197 | BASARAMATIA | India | 5 (75.25) | 3 (60) | 35.246875 | 5.565 |
198 | Birupa | Odisha, India | 5 (80.25) | 5 (70) | 27.946875 | 4.745 |
199 | Naveen | Odisha, India | 5 (90.25) | 5 (95) | 23.846875 | 5.755 |
200 | Bowdel | India | 1 (95.25) | 1 (90) | 68.046875 | 12.665 |
201 | IR 72 | IRRI, Phillippines | 5 (75.25) | 5 (75) | 31.246875 | 4.285 |
202 | LALSANKRI | India | 1 (90.25) | 1 (90) | 61.146875 | 11.365 |
203 | CR2340-2 | NRRI, Cuttack, India | 1 (98.25) | 1 (95) | 81.546875 | 10.315 |
204 | TEPIBORO | Assam, India | 1 (95.25) | 1 (95) | 44.246875 | 10.315 |
205 | BORI | India | 3 (90.25) | 3 (90) | 50.846875 | 9.925 |
206 | CR2340-1 | NRRI, Cuttack, India | 3 (75.25) | 1 (70) | 61.946875 | 11.625 |
207 | Vijetha | Andhra Pradesh, India | 7 (70.25) | 5 (75) | 26.946875 | 5.325 |
208 | SURJAMUKHI | India | 1 (95.25) | 1 (95) | 64.446875 | 12.955 |
209 | Divya | India | 5 (80.25) | 3 (85) | 29.146875 | 4.645 |
210 | Pusa 44 | Uttar Pradesh, India | 7 (85.25) | 5 (80) | 21.946875 | 3.275 |
211 | FULLKATI | India | 3 (85.25) | 3 (85) | 55.746875 | 9.685 |
212 | MENKASALA | India | 3 (90.25) | 3 (90) | 48.146875 | 10.385 |
213 | ADT 43 | Tamil Nadu, India | 7 (75.25) | 5 (80) | 23.046875 | 4.715 |
214 | CR2463-25 | NRRI, Cuttack | 5 (80.25) | 5 (90) | 27.746875 | 5.315 |
215 | Khitish | West Bengal, India | 5 (70.25) | 5 (70) | 23.346875 | 4.715 |
216 | Shaktiman | Odisha, India | 5 (67) | 5 (71) | 27.321875 | 5.035 |
217 | MURIDANRA | India | 3 (82) | 3 (71) | 49.121875 | 10.685 |
218 | BAILAM | Bangladesh | 3 (82) | 3 (83) | 54.121875 | 11.465 |
219 | Bhoi | Odisha, india | 7 (87) | 5 (81) | 23.021875 | 5.525 |
220 | RAISARIA | India | 3 (72) | 3 (76) | 53.421875 | 11.565 |
221 | Indira | Odisha, India | 5 (62) | 5 (66) | 24.721875 | 4.215 |
222 | Ratna | Odisha, India | 5 (67) | 5 (61) | 23.121875 | 5.285 |
223 | SERETY | Korea | 3 (87) | 3 (81) | 63.421875 | 12.565 |
224 | Konark | Odisha, India | 5 (77) | 5 (71) | 24.321875 | 5.415 |
225 | Prasad | India | 5 (67) | 5 (61) | 25.421875 | 6.415 |
226 | DV123 | IRRI, Philippines | 3 (77) | 3 (71) | 54.521875 | 11.865 |
227 | BORO 4005 | NRRI, Cuttack, India | 5 (87) | 5 (81) | 32.021875 | 5.045 |
228 | CR3813-4-4-4-2-2 | NRRI, Cuttack, India | 1 (82) | 1 (86) | 72.321875 | 11.425 |
229 | BG301 | Sri Lanka | 3 (77) | 3 (71) | 53.521875 | 11.765 |
230 | Jajati | Odisha, India | 7 (92) | 5 (71) | 22.021875 | 4.345 |
231 | Radhi | Odisha, India | 7 (82) | 5 (71) | 25.721875 | 5.375 |
232 | MANDRIRA | IRRI, Philippine | 3 (87) | 3 (81) | 61.621875 | 10.705 |
233 | Sravani | Odisha, India | 7 (92) | 5 (71) | 24.721875 | 5.485 |
234 | Sasyasree | Odisha, India | 7 (87) | 5 (71) | 23.821875 | 5.315 |
235 | Gajapati | Odisha, India | 7 (92) | 7 (91) | 20.321875 | 4.715 |
236 | Bhavani | Odisha, India | 7 (82) | 5 (66) | 29.721875 | 4.385 |
237 | CSR90 | Haryana, India | 5 (82) | 5 (86) | 24.321875 | 6.705 |
238 | IR 50 | IRRI, Philippines | 7 (92) | 7 (91) | 20.721875 | 4.415 |
239 | CR3820-4-5-5-3-1 | NRRI, Cuttack, India | 7 (82) | 5 (76) | 33.221875 | 5.485 |
240 | Tapaswini | Odisha, India | 7 (87) | 7 (81) | 20.421875 | 4.315 |
241 | YN1353-3 | IRRI, Philippines | 3 (87) | 3 (81) | 53.521875 | 10.525 |
242 | Ananga | Odisha, India | 7 (87) | 7 (81) | 21.121875 | 5.415 |
243 | Chandan | Odisha, india | 5 (87) | 3 (81) | 29.621875 | 6.415 |
244 | HABIGONJ BORO6 | Bangladesh | 3 (67) | 3 (56) | 65.121875 | 12.465 |
245 | CR3621-6-1-3-1-2 | NRRI, Cuttack, india | 3 (77) | 3 (81) | 49.321875 | 8.525 |
246 | Satabdi | West Bengal, Odisha | 7 (100) | 7 (99) | 20.821875 | 4.485 |
247 | BAMAWPYAN | IRRI, Philippine | 1 (92) | 1 (91) | 64.421875 | 11.765 |
248 | Kshira | Odisha, india | 7 (87) | 7 (81) | 19.021875 | 5.305 |
249 | CR 2461-9 | NRRI, Cuttack, india | 5 (92) | 3 (71) | 39.121875 | 7.415 |
250 | IR 8 | IRRI, Philippines | 7 (92) | 5 (76) | 21.921875 | 5.015 |
251 | Gouri | Odisha, India | 7 (97) | 7 (93) | 19.721875 | 4.745 |
252 | Vikramarya | India | 5 (77) | 5 (71) | 24.021875 | 5.615 |
253 | CR Dhan 208 | NRRI, Cuttack, India | 5 (77) | 3 (66) | 43.121875 | 8.815 |
254 | Luit | Assam, India | 5 (87) | 5 (91) | 22.821875 | 4.855 |
255 | CO 43 | Tamil Nadu, India | 7 (92) | 7 (91) | 16.821875 | 5.675 |
256 | Kalyani 2 | Odisha, India | 7 (77) | 5 (61) | 28.621875 | 8.785 |
257 | Kalakeri | Jharkhand, India | 3 (87) | 3 (86) | 67.721875 | 11.025 |
258 | Browngora | Jharkhand, India | 3 (94) | 3 (91) | 54.221875 | 10.525 |
259 | CR3825-2-1-2-2-4 | NRRI, Cuttack, India | 5 (74.5) | 5 (81) | 23.971875 | 5.3275 |
260 | Sneha | Odisha, India | 7 (91.5) | 7 (91) | 17.571875 | 4.3875 |
261 | Lalnakanda | India | 3 (84.5) | 1 (81) | 64.471875 | 10.7675 |
262 | LAXMIKAJAL | India | 3 (84.5) | 1 (86) | 52.971875 | 9.6675 |
263 | CR 143-2-2 | NRRI, Cuttack, India | 1 (94.5) | 1 (96) | 80.471875 | 12.3875 |
264 | WAB 56-50 | Africa | 5 (69.5) | 5 (76) | 26.371875 | 7.4475 |
265 | WITA 10 | Africa | 5 (64.5) | 5 (61) | 33.971875 | 7.3675 |
266 | Govind | Uttar Pradesh, India | 7 (84.5) | 5 (76) | 27.371875 | 5.3575 |
267 | KASARAKUNDA | India | 3 (74.5) | 3 (66) | 51.671875 | 10.7575 |
268 | CR Dhan 601 | Odisha, India | 5 (69.5) | 5 (76) | 42.271875 | 7.6675 |
269 | Rasi | Andhra Pradesh, India | 3 (79.5) | 3 (76) | 48.071875 | 9.4775 |
270 | CR3825-2-1-2-2-3 | NRRI, Cuttack, India | 5 (74.5) | 3 (71) | 34.971875 | 6.4675 |
271 | Jyothi | Kerala, India | 5 (74.5) | 3 (66) | 27.071875 | 4.6575 |
272 | Nidhi | Tamil Nadu, India | 7 (84.5) | 7 (81) | 16.971875 | 3.3575 |
273 | PUNEI | India | 3 (64.5) | 3 (61) | 41.671875 | 8.7975 |
274 | CR3820-4-5-3-1-3 | NRRI, Cuttack, India | 7 (89.5) | 7 (91) | 41.371875 | 3.3575 |
275 | ADT 45 | Tamil Nadu, India | 7 (84.5) | 5 (76) | 23.971875 | 5.6675 |
276 | DUMERPHULLI | India | 3 (74.5) | 3 (81) | 53.771875 | 11.5075 |
277 | Ratnagiri 3 | Maharashtra, India | 5 (79.5) | 5 (86) | 27.471875 | 6.4275 |
278 | Mahamaya | Chhattisgarh, India | 7 (74.5) | 5 (66) | 21.671875 | 5.7875 |
279 | LAHDIL | India | 3 (74.5) | 3 (71) | 48.171875 | 9.9775 |
280 | Kushal | India | 5 (59.5) | 5 (66) | 25.071875 | 6.4975 |
281 | CR3621-6-1-3-1-1 | NRRI, Cuttack, India | 5 (84.5) | 3 (83) | 34.071875 | 6.5575 |
282 | HAZARIDHAN | Jharkhand, India | 3 (89.5) | 3 (86) | 42.171875 | 8.6675 |
283 | CR3820-2-1-5-1-2 | NRRI, Cuttack, India | 5 (84.5) | 5 (81) | 25.271875 | 6.3475 |
284 | KALINGA II | Odisha, India | 5 (74.5) | 3 (71) | 39.171875 | 8.2675 |
285 | Bhadra | India | 5 (64.5) | 5 (66) | 28.771875 | 5.3475 |
286 | CR3826-8-3-2-1-1 | NRRI, Cuttack, India | 5 (74.5) | 5 (71) | 28.571875 | 7.3575 |
287 | Pant Dhan19 | Uttarakhand, India | 5 (74.5) | 5 (71) | 22.571875 | 5.7775 |
288 | Pant Dhan18 | Uttarakhand, India | 7 (79.5) | 5 (76) | 18.371875 | 4.9575 |
289 | ADT 47 | Tamil Nadu, India | 7 (89.5) | 5 (71) | 16.571875 | 5.2575 |
290 | Jawahar | India | 5 (64.5) | 5 (61) | 26.971875 | 5.7875 |
291 | Jaya | Andhra Pradesh, India | 7 (94.5) | 7 (96) | 19.471875 | 4.6675 |
292 | CR3622-7-3-2-2 | NRRI, Cuttack, India | 5 (84.5) | 5 (81) | 27.871875 | 6.4275 |
293 | CR3622-7-3-1-1 | NRRI, Cuttack, India | 5(74.5) | 5 (76) | 27.271875 | 6.9575 |
294 | JGL 1798 | Andhra Pradesh, India | 7 (84.5) | 5 (76) | 22.171875 | 4.4275 |
295 | IET 19879 | India | 7 (69.5) | 5 (76) | 21.771875 | 4.2275 |
296 | IET 19985 | India | 5 (79.50 | 5 (76) | 33.971875 | 7.1275 |
297 | IET 20538 | India | 5 (74.5) | 3 (76) | 37.971875 | 6.3175 |
298 | IET 20526 | India | 5 (69.5) | 5 (71) | 26.571875 | 5.7475 |
299 | PMK-2 | Tamil Nadu, India | 7 (64.5) | 7 (66) | 16.171875 | 3.6075 |
300 | TKM-11 | Tamil Nadu, India | 7 (79.5) | 7 (86) | 16.871875 | 3.9575 |
301 | IET 20532 | India | 3 (89.5) | 3 (89) | 63.771875 | 11.3875 |
302 | IET 20525 | India | 3 (85.25) | 3 (80.25) | 56.896875 | 11.26 |
303 | IET 20529 | India | 3 (80.25) | 3 (80.25) | 56.196875 | 11.44 |
304 | IET 20559 | India | 5 (75.25) | 3 (70.25) | 34.196875 | 5.77 |
305 | IET 20533 | India | 5 (70.25) | 3 (75.25) | 33.396875 | 6.53 |
306 | Udayagiri | Odisha, India | 5 (80.25) | 5 (85. 25) | 23.246875 | 6.41 |
307 | Sebati | Odisha, India | 7 (75.25) | 7 (70.25) | 18.196875 | 4.39 |
308 | Pavithra | Kerala, India | 7 (75.25) | 7 (70.25) | 18.896875 | 4.74 |
309 | Uma | Kerala, India | 7 (85.25) | 7 (80.25) | 16.116875 | 4.53 |
310 | Kairaly | Kerala, india | 7 (85.25) | 7 (85.25) | 16.916875 | 4.31 |
311 | IET 20540 | India | 3 (75.25) | 3 (75.25) | 52.496875 | 11.43 |
312 | IET 20534 | India | 5 (65.25) | 5 (70.25) | 31.596875 | 6.4 |
313 | IET 20545 | India | 3 (90.25) | 3 (85.25) | 55.396875 | 10.66 |
314 | IET 20556 | India | 5 (75.25) | 3 (70.25) | 28.496875 | 6.83 |
315 | IET 20557 | India | 3 (88.25) | 3 (85.25) | 53.796875 | 10.39 |
316 | IET 20535 | India | 5 (75.25) | 3 (65.25) | 38.596875 | 6.9 |
317 | Sidhanta | Odisha, india | 7 (90.25) | 7 (95.25) | 21.696875 | 4.5 |
318 | Bharani | Andhra Pradesh, India | 7 (80.25) | 7 (85.25) | 17.916875 | 4.74 |
319 | Co-47 | Tamil Nadu, India | 7 (80.25) | 7 (80.25) | 14.816875 | 3.04 |
320 | Jaldi dhan-13 | West Bengal, India | 5 (75.25) | 5 (70.25) | 30.796875 | 7.86 |
321 | GR-9 | Gujarat, India | 7 (85.25) | 7 (85.25) | 16.946875 | 3.82 |
322 | IET 20561 | India | 3 (75.25) | 3 (70.25) | 52.796875 | 9.07 |
323 | IET 20622 | India | 58 (80.25) | 3 (75.25) | 35.596875 | 6.64 |
324 | IET 20601 | India | 5 (78.25) | 3 (75.25) | 32.796875 | 6.86 |
325 | IET 20614 | India | 5 (85.25) | 3 (70.25) | 42.096875 | 6.53 |
326 | IET 19140 | India | 3 (80.25) | 3 (75.25) | 42.996875 | 10.74 |
327 | IET 19972 | India | 5 (85.25) | 5 (80.25) | 21.496875 | 7.5 |
328 | Heera | Odisha, India | 5 (75.25) | 3 (60.25) | 60.696875 | 11.04 |
329 | KalingaIII | Odisha, India | 5 (85.25) | 3 (80.25) | 27.396875 | 7.16 |
330 | Geetanjali | Odisha, India | 7 (95.25) | 7 (95.25) | 16.796875 | 3.9 |
331 | Kamesh | Jharkhand, India | 3 (75.25) | 3 (70.25) | 60.496875 | 7.54 |
332 | Parijat | Odisha, India | 5 (70.25) | 5 (70.25) | 23.796875 | 5.74 |
333 | Naveen | Odisha, India | 5 (65.25) | 5 (60.25) | 26.196875 | 6.53 |
334 | Sadavahar | Jharkhand, India | 5 (65.25) | 3 (70.25) | 42.796875 | 7.03 |
335 | Vanaprava | Odisha, India | 5 (85.25) | 3 (75.25) | 34.296875 | 6.7 |
336 | Abhisek | Jharkhand, India | 3 (85.25) | 3 (80.25) | 47.996875 | 10.5 |
337 | Anjali | Jharkhand, India | 3 (90.25) | 3 (95.25) | 58.796875 | 12.41 |
338 | Phalguni | Odisha, India | 7 (98.25) | 7 (98.25) | 23.996875 | 3.2 |
339 | Samaleswari | Chhattisgarh, India | 7 (95.25) | 7 (90.25) | 15.896875 | 3.63 |
340 | Phule Radha | Maharashtra, India | 7 (90.25) | 7 (95.25) | 17.096875 | 4.4 |
341 | Manaswini | Odisha, India | 7 (90.25) | 7 (88.25) | 19.096875 | 5.03 |
342 | Sahyadri-4 | Maharashtra, India | 7 (88.25) | 7 (85.25) | 21.096875 | 5.43 |
343 | RC Maniphou-6 | Manipur, India | 7 (80.25) | 7 (82.25) | 23.796875 | 6.33 |
344 | Karjat-7 | Maharashtra, India | 7 (82.25) | 7 (84.25) | 21.896875 | 5.98 |
345 | N22 (Tolerant check) | Uttar Pradesh, India | 1 (98) | 1 (98) | 83.225 | 13.24 |
346 | Dular (Tolerant check) | Odisha, India | 1 (94) | 1 (90) | 71.825 | 12.38 |
347 | IR64 (Susceptible check) | IRRI, Philippines | 7 (82) | 7 (80) | 9.13 | 1.85 |
348 | IR20 (Susceptible check) | IRRI, Philippines | 7 (95) | 7 (96) | 6.2 | 1.26 |
Control treatment means | Standard error of difference | 1.06346 | 0.75986 | 0.54420 | 0.19385 | |
Tukey's HSD at 5% | 8.6645 | 6.1909 | 4.4338 | 1.57938 | ||
Test treatment in the same block | Standard error of difference | 3.00793 | 2.14920 | 1.53922 | 0.54829 | |
Tukey's HSD at 5% | 24.5068 | 17.510 | 12.5407 | 4.46716 | ||
Test treatment not in the same block | Standard error of difference | 3.36296 | 2.40288 | 1.72090 | 0.61301 | |
Tukey's HSD at 5% | 27.3995 | 19.5772 | 14.0209 | 4.99444 | ||
Test treatment and a control treatment | Standard error of difference | 2.46554 | 1.76165 | 1.26167 | 0.44942 | |
Tukey's HSD at 5% | 20.08 | 14.3529 | 10.2793 | 3.66164 |
Supplemental Table 1. Leaf rolling, leaf drying, spikelet fertility and single plant yield of 348 early and mid-early duration germplasm lines under moderate drought stress.
No. | Accession | Origin/place of adaption | Leaf rolling | Leaf drying | Spikelet fertility (%) | Single plant yield (g) |
---|---|---|---|---|---|---|
1 | ARC12071 | Assam, India | 3 (89.25) | 3 (84.25) | 63.0218 | 10.55 |
2 | Ac 10984 | India | 1 (94.25) | 1 (89.25) | 81.8218 | 11.57 |
3 | Ac 39800 | India | 3 (94.25) | 3 (89.25) | 63.8218 | 10.15 |
4 | NSIC Rc 106 | IRRI, Philippines | 7 (84.25) | 7 (79.25) | 15.8818 | 4.255 |
5 | Ac 39739 | India | 3 (89.25) | 3 (85.25) | 65.1218 | 9.245 |
6 | HONGZUI EL | IRRI, Philippines | 7 (89.25) | 5 (84.25) | 28.271875 | 6.235 |
7 | Ac 39804 | India | 3 (94.25) | 3 (89.25) | 61.321875 | 10.335 |
8 | Ac 10914 | India | 1 (95.25) | 1 (89.25) | 83.121875 | 12.305 |
9 | Ac 39770 | India | 3 (92.25) | 3 (89.25) | 61.821875 | 9.835 |
10 | BENAMURI | Odisha, India | 5 (79.25) | 3 (79.25) | 43.071875 | 7.525 |
11 | Ac 39737 | India | 3 (84.25) | 3 (84.25) | 65.121875 | 10.345 |
12 | Ac 39955 | India | 3 (94.25) | 3 (89.25) | 62.021875 | 9.935 |
13 | Ac 39843 | India | 1 (97.25) | 1 (94.25) | 74.321875 | 12.355 |
14 | SATHI | Utter Pradesh, India | 5 (74.25) | 3 (79.25) | 46.221875 | 8.355 |
15 | Ac 39769 | India | 3 (84.25) | 3 (87.25) | 45.321875 | 9.555 |
16 | Ac 39933 | India | 3 (87.25) | 3 (89.25) | 49.921875 | 10.975 |
17 | Ac 39794 | India | 3 (89.25) | 3 (91.25) | 48.921875 | 10.535 |
18 | DZ78 | IRRI, Philippines | 5 (79.25) | 5 (84.25) | 33.121875 | 6.775 |
19 | Ac39827 | India | 5 (74.25) | 5 (79.25) | 42.721875 | 6.615 |
20 | Ac 39928 | India | 5 (84.25) | 5 (79.25) | 30.121875 | 5.475 |
21 | Ac 39823 | India | 5 (89.25) | 5 (84.25) | 29.221875 | 5.675 |
22 | SUDUWEE | IRRI, Philippines | 5 (89.25) | 3 (74.25) | 41.871875 | 7.245 |
23 | Ac 39871 | India | 3 (94.25) | 3 (91.25) | 49.321875 | 10.355 |
24 | Ac 39781 | India | 3 (97.25) | 3 (94.25) | 61.921875 | 9.565 |
25 | Ac 39773 | India | 3 (91.25) | 3 (89.25) | 49.521875 | 9.585 |
26 | KHAODAW | Thailand | 5 (89.25) | 3 (87.25) | 38.121875 | 7.115 |
27 | Ac 39795 | India | 3 (91.25) | 3 (89.25) | 61.321875 | 8.975 |
28 | Ac 39776 | India | 5 (89.25) | 5 (84.25) | 33.921875 | 6.375 |
29 | EZI | China | 5 (95.25) | 5 (91.25) | 33.121875 | 5.255 |
30 | Ac 39910 | India | 5 (91.25) | 5 (89.25) | 38.421875 | 6.645 |
31 | Ac 10931 | India | 3 (94.25) | 3 (91.25) | 58.821875 | 9.645 |
32 | MADHABSA | Bangadesh | 5 (84.25) | 5 (79.25) | 33.741875 | 6.225 |
33 | Ac 39749 | India | 3 (94.25) | 3 (91.25) | 65.321875 | 10.355 |
34 | Ac 39792 | India | 7 (97.25) | 7 (96.25) | 6.121875 | 4.205 |
35 | ARC 10319 | Assam, India | 5 (89.25) | 3 (89.25) | 36.021875 | 7.845 |
36 | Ac 10981 | India | 5 (91.25) | 5 (89.25) | 19.921875 | 5.975 |
37 | Ac 39755 | India | 5 (84.25) | 5 (79.25) | 20.121875 | 6.475 |
38 | Ac 39733 | India | 3 (89.25) | 3 (87.25) | 61.421875 | 10.575 |
39 | Ac 39760 | India | 3 (91.25) | 3 (89.25) | 46.621875 | 10.115 |
40 | Ac 10939 | India | 3 (93.25) | 3 (89.25) | 63.321875 | 10.535 |
41 | ARC10818 | Assam, India | 7 (94.25) | 7 (91.25) | 21.841875 | 4.515 |
42 | Ac 11206 | India | 7 (95.25) | 5 (87.25) | 6.421875 | 5.575 |
43 | Ac 39834 | India | 5 (74.25) | 5 (79.25) | 20.021875 | 6.645 |
44 | AL LANKE | - | 5 (80) | 5 (81.5) | 30.821875 | 5.07 |
45 | Ac 10816 | India | 3 (78) | 3 (79.5) | 61.721875 | 9.97 |
46 | Ac 11209 | India | 7 (85) | 5 (79.5) | 6.921875 | 4.87 |
47 | HARBHOOND | Madhya Pradesh, India | 3 (85) | 3 (86.5) | 40.921875 | 8.95 |
48 | Ac 10820 | India | 3 (90) | 3 (91.5) | 63.221875 | 9.07 |
49 | Ac 11261 | India | 1 (98) | 1 (94.5) | 81.921875 | 12.54 |
50 | HAWSHAO | IRRI, Philippines | 5 (75) | 5 (77.5) | 23.921875 | 5.52 |
51 | Ac 10995 | India | 3 (80) | 3 (81.5) | 47.321875 | 9.63 |
52 | Ac 10914 | India | 7 (98) | 7 (94.5) | 17.221875 | 5.05 |
53 | RAY JAZAYKAYZ | IRRI, Philippines | 3 (88) | 3 (84.5) | 47.521875 | 8.51 |
54 | Ac 10837 | India | 5 (70) | 3 (64.5) | 38.621875 | 6.64 |
55 | Ac 11087 | India | 7 (95) | 7 (94.5) | 7.521875 | 4.62 |
56 | AUS 439 | Assam, India | 5 (82) | 5 (79.5) | 29.921875 | 5.87 |
57 | Ac 10843 | India | 5 (65) | 3 (69.5) | 40.821875 | 5.51 |
58 | Ac 10840 | India | 5 (75) | 3 (69.5) | 42.121875 | 5.71 |
59 | Ac 11074 | India | 7 (95) | 7 (91.5) | 19.221875 | 4.95 |
60 | RR 272-17- | Jharkhand, India | 5 (92) | 5 (89.5) | 27.921875 | 5.28 |
61 | Ac 10990 | India | 5 (85) | 5 (81.5) | 37.321875 | 7.24 |
62 | Ac 11462 | India | 3 (85) | 3 (84.5) | 58.321875 | 7.05 |
63 | RAB-56-50 | Africa | 5 (90) | 3 (87.5) | 31.921875 | 6.74 |
64 | Ac 10956 | India | 5 (92) | 5 (89.5) | 39.821875 | 5.02 |
65 | Ac 10811 | India | 7 (75) | 5 (71.5) | 16.821875 | 6.04 |
66 | Ac 10875 | India | 5 (78) | 3 (74.5) | 40.921875 | 5.97 |
67 | Heera | Odisha, India | 5 (72) | 3 (77.5) | 40.521875 | 7.08 |
68 | Ac 11069 | India | 1 (95) | 3 (84.5) | 67.421875 | 9.07 |
69 | Ac 10965 | India | 3 (90) | 3 (87.5) | 63.721875 | 8.08 |
70 | Ac 10857 | India | 3 (92) | 3 (89.5) | 46.521875 | 9.27 |
71 | DASARAMATIA | India | 5 (78) | 3 (74.5) | 41.521875 | 7.28 |
72 | Ac 39911 | India | 5 (80) | 3 (74.5) | 33.821875 | 6.94 |
73 | Ac 39750 | India | 7 (80) | 5 (77.5) | 16.821875 | 6.04 |
74 | Ac 39957 | India | 3 (85) | 3 (84.5) | 63.121875 | 8.74 |
75 | JALIA | India | 5 (78) | 3 (74.5) | 35.821875 | 7.49 |
76 | Ac 10862 | India | 5 (68) | 3 (69.5) | 42.521875 | 6.37 |
77 | Ac 10915 | India | 3 (85) | 3 (84.5) | 36.121875 | 8.75 |
78 | Ac 39870 | India | 3 (88) | 3 (84.5) | 37.121875 | 8.54 |
79 | HASURIDHAN | India | 5 (90) | 5 (84.5) | 30.921875 | 5.93 |
80 | Ac 10994 | India | 7 (95) | 5 (79.5) | 17.521875 | 5.72 |
81 | Ac 10984 | India | 3 (93) | 3 (89.5) | 45.621875 | 9.61 |
82 | CR143-2-2 | NRRI, Cuttack, India | 1 (98) | 1 (94.5) | 70.621875 | 12.65 |
83 | Ac 10954 | India | 7 (75) | 5 (69.5) | 18.021875 | 4.6 |
84 | Ac 39840 | India | 3 (85) | 3 (84.5) | 58.321875 | 9.05 |
85 | SADABAHAR | Jharkhand, India | 5 (80) | 3 (74.5) | 36.821875 | 6.99 |
86 | Ac 10958 | India | 3 (90) | 3 (87.5) | 60.621875 | 9.6 |
87 | Ac 10925 | India | 7 (92.25) | 7 (92) | 16.771875 | 4.775 |
88 | RR347-1 | Jharkhand, India | 5 (82.25) | 3 (80) | 41.171875 | 7.315 |
89 | Ac 10976 | India | 1 (96.25) | 1 (94) | 65.471875 | 12.765 |
90 | Ac 11085 | India | 5 (85.25) | 3 (80) | 36.871875 | 6.465 |
91 | Ac 10957 | India | 5 (85.25) | 3 (85) | 34.971875 | 5.665 |
92 | LALANKANDA-41 | India | 1 (98.25) | 1 (95) | 69.471875 | 11.465 |
93 | Ac 11433 | India | 3 (92.25) | 3 (90) | 61.271875 | 9.445 |
94 | Ac 39975 | India | 3 (80.25) | 1 (85) | 64.671875 | 8.765 |
95 | Ac 11280 | India | 3 (85.25) | 3 (85) | 61.771875 | 8.675 |
96 | Ac 11217 | India | 3 (90.25) | 3 (90) | 63.171875 | 9.865 |
97 | RR-2-6 | Jharkhand, India | 3 (85.25) | 3 (90) | 51.571875 | 10.775 |
98 | Ac 11114 | India | 7 (85.25) | 5 (80) | 15.471875 | 5.665 |
99 | Ac 11328 | India | 5 (80.25) | 3 (78) | 38.071875 | 6.795 |
100 | JOGESH | Jharkhand, India | 3 (92.25) | 3 (92) | 45.571875 | 9.575 |
101 | Ac 11030 | India | 3 (90.25) | 3 (90) | 43.071875 | 8.965 |
102 | Ac 10925 | India | 1 (95.25) | 1 (95) | 65.871875 | 12.665 |
103 | Dinorado | Philippines | 1 (96.25) | 1 (96) | 62.371875 | 13.415 |
104 | Ac 11007 | India | 3 (90.25) | 3 (92) | 46.671875 | 9.435 |
105 | Ac 39890 | India | 1 (98.25) | 1 (95) | 82.071875 | 11.735 |
106 | Ac 11258 | India | 3 (65.25) | 3 (70) | 61.771875 | 9.335 |
107 | RR-348-6 | Jharkhand, India | 5 (70.25) | 3 (80) | 39.771875 | 8.735 |
108 | Ac 11265 | India | 3 (80.25) | 3 (90) | 55.071875 | 9.455 |
109 | Ac 11205 | India | 3 (85.25) | 3 (80) | 46.471875 | 9.275 |
110 | RR-665-645 | Jharkhand, India | 5 (75.25) | 3 (70) | 37.171875 | 8.625 |
111 | Ac 11333 | India | 3 (70.25) | 3 (75) | 38.871875 | 8.665 |
112 | Ac 11246 | India | 3 (88.25) | 3 (85) | 36.971875 | 8.765 |
113 | VANAPRABHA | Odisha, India | 5 (78.25) | 3 (75) | 35.571875 | 7.665 |
114 | Ac 11311 | India | 3 (90.25) | 1 (88) | 63.571875 | 9.535 |
115 | Ac 11057 | India | 3 (95.25) | 3 (90) | 47.271875 | 8.775 |
116 | RR20 | Jharkhand, India | 5 (90.25) | 5 (90) | 32.371875 | 5.845 |
117 | Ac 11464 | India | 3 (85.25) | 3 (80) | 48.371875 | 8.965 |
118 | RR160-10 | Jharkhand, India | 7 (98.25) | 7 (98) | 17.231875 | 4.445 |
119 | RR 51-1 | Jharkhand, India | 3 (95.25) | 3 (95) | 52.271875 | 10.535 |
120 | RR 347-466 | Jharkhand, India | 7 (98.25) | 7 (98) | 16.291875 | 4.735 |
121 | Ac 39963 | India | 3 (92.25) | 3 (92) | 63.171875 | 8.195 |
122 | KHANDAGIRI | Odisha, India | 3 (95.25) | 3 (95) | 54.271875 | 10.575 |
123 | Ac 39753 | India | 7 (75.25) | 5 (70) | 19.871875 | 5.875 |
124 | Ac 39839 | India | 3 (90.25) | 3 (95) | 48.871875 | 9.665 |
125 | BLACKGORA | Jharkhand, India | 3 (80.25) | 3 (90) | 51.571875 | 11.575 |
126 | Ac 39762 | India | 7 (75.25) | 5 (80) | 19.471875 | 4.865 |
127 | RR354-1 | Jharkhand, India | 3 (90.25) | 3 (88) | 52.271875 | 11.565 |
128 | RR 272-1745 | Jharkhand, India | 3 (92.25) | 3 (90) | 54.571875 | 11.575 |
129 | Ac 39973 | India | 1 (96.25) | 1 (95) | 82.371875 | 12.855 |
130 | Ac 10374 | India | 7 (83.5) | 5 (79) | 18.946875 | 5.7525 |
131 | SATYABHAMA | Odisha, India | 3 (93.5) | 3 (89) | 63.146875 | 14.2625 |
132 | Ac 39797 | India | 3 (86.5) | 3 (84) | 63.446875 | 9.5325 |
133 | Ac 10978 | India | 7 (78.5) | 3 (74) | 18.146875 | 5.2025 |
134 | PYARI | Odisha, India | 3 (93.5) | 3 (74) | 51.946875 | 11.5625 |
135 | Ac 10964 | India | 3 (88.5) | 3 (91) | 56.246875 | 8.4225 |
136 | Ac 10972 | India | 3 (93.5) | 3 (89) | 62.146875 | 10.0025 |
137 | CR DHAN204 | NRRI, Cuttack, India | 5 (73.5) | 3 (69) | 46.546875 | 9.7325 |
138 | Ac 10899 | India | 7 (93.5) | 7 (94) | 19.046875 | 3.8625 |
139 | Ac 39759 | India | 7 (88.5) | 5 (79) | 19.546875 | 5.1225 |
140 | Ac 39893 | India | 3 (93.5) | 3 (94) | 63.246875 | 8.5325 |
141 | CR DHAN 202 | NRRI, Cuttack, India | 3 (90.5) | 3 (89) | 62.546875 | 13.1425 |
142 | Ac 10972 | India | 5 (73.5) | 3 (69) | 28.846875 | 6.3325 |
143 | Ac 11152 | India | 3 (78.5) | 3 (84) | 63.946875 | 9.7625 |
144 | Ac 11322 | India | 3 (83.5) | 1 (89) | 63.146875 | 8.1325 |
145 | CR DHAN 201 | NRRI, Cuttack, India | 5 (78.5) | 3 (89) | 52.946875 | 9.3625 |
146 | Ac 10994 | India | 3 (83.5) | 1 (79) | 63.546875 | 7.8625 |
147 | Ac 39790 | India | 1 (92.5) | 1 (89) | 81.346875 | 11.5625 |
148 | Ac 10993 | India | 5 (82.5) | 3 (81) | 29.346875 | 5.4325 |
149 | KALCHI | India | 5 (84.5) | 5 (79) | 23.446875 | 5.0925 |
150 | Ac 11202 | India | 5 (88.5) | 3 (84) | 28.746875 | 4.5625 |
151 | Ac 11208 | India | 5 (83.5) | 3 (81) | 26.646875 | 5.6625 |
152 | Ac 10957 | India | 3 (90.5) | 3 (89) | 63.246875 | 9.2125 |
153 | SETKA | India | 5 (63.5) | 5 (74) | 21.646875 | 5.0925 |
154 | IR10C-137 | IRRI, Philippines | 3 (83.5) | 1 (89) | 64.546875 | 8.3325 |
155 | IR10C-167 | IRRI, Philippines | 1 (83.5) | 1 (79) | 80.946875 | 10.2325 |
156 | IR10C-136 | IRRI, Philippines | 3 (78.5) | 1 (84) | 65.246875 | 7.8625 |
157 | CHINGERDHAN | India | 3 (88.5) | 3 (89) | 54.946875 | 9.3625 |
158 | IR83142-B-36-B | IRRI, Philippines | 3 (83.5) | 1 (79) | 61.646875 | 8.5625 |
159 | IR10C-108 | IRRI, Philippines | 3 (78.5) | 1 (89) | 63.546875 | 11.3325 |
160 | BUNDEI | India | 3 (73.5) | 3 (74) | 52.446875 | 10.4425 |
161 | IR10C-161 | IRRI, Philippines | 1 (93.5) | 1 (89) | 66.446875 | 13.4625 |
162 | SHELLA | India | 5 (68.5) | 3 (79) | 36.746875 | 8.4425 |
163 | CR Dhan 301 | NRRI, Cuttack | 7 (88.5) | 7 (89) | 17.946875 | 3.4425 |
164 | IR10C-110 | IRRI, Philippines | 3 (83.5) | 1 (89) | 62.246875 | 10.7325 |
165 | DHOBOSANKARI | India | 3 (80.5) | 3 (81) | 45.946875 | 9.6425 |
166 | CR Dhan 303 | NRRI, Cuttack, India | 7 (92.5) | 7 (93) | 18.546875 | 3.5025 |
167 | IR10C-179 | IRRI, Philippines | 3 (73.5) | 1 (79) | 63.046875 | 11.5325 |
168 | CR Dhan 304 | NRRI, Cuttack, India | 7 (88.5) | 7 (89) | 18.466875 | 3.1325 |
169 | IR10C-103 | IRRI, Philippines | 3 (73.5) | 1(79) | 64.746875 | 12.2325 |
170 | KARNI | India | 1 (96.5) | 1 (97) | 63.146875 | 12.1825 |
171 | CR Dhan 305 | NRRI, Cuttack, India | 5 (80.5) | 5 (79) | 27.546875 | 6.4625 |
172 | IR10C-126 | IRRI, Philippines | 3 (83.5) | 1 (79) | 62.446875 | 10.5325 |
173 | DENGBOREI | Eastern India | 3 (80.25) | 3 (75) | 52.046875 | 10.865 |
174 | IR10G-103 | IRRI, Philippines | 1 (85.25) | 1 (80) | 65.846875 | 13.885 |
175 | CR Dhan 306 | NRRI, Cuttack, India | 7 (90.25) | 7 (90) | 15.946875 | 3.215 |
176 | SEKRE | EasternIndia | 7 (85.25) | 7 (85) | 18.146875 | 3.345 |
177 | Maudamani | NRRI, Cuttack, India | 7 (98.25) | 7 (98) | 15.146875 | 3.585 |
178 | CR Dhan 309 | NRRI, Cuttack, India | 7 (98.25) | 7 (95) | 17.746875 | 4.685 |
179 | CR Dhan 205 | NRRI, Cuttack, India | 5 (85.25) | 3 (75) | 43.046875 | 8.925 |
180 | TAWADHAN | Northern India | 5 (75.25) | 3 ( 70) | 40.246875 | 8.715 |
181 | IR83141-B-32-B | IRRI, Philippines | 3 (85.25) | 1 (80) | 63.746875 | 13.625 |
182 | IR64197-3B-15-2 | IRRI, Philippines | 3 (85.25) | 1 (85) | 63.946875 | 13.295 |
183 | CR Dhan 206 | NRRI, Cuttack, India | 5 (92.25) | 5 (90) | 33.346875 | 7.985 |
184 | KUTIARASI | India | 3 (95.25) | 3 (92) | 60.746875 | 12.915 |
185 | CR Dhan 207 | NRRI, Cuttack, India | 5 (85.25) | 3 (65) | 38.146875 | 8.715 |
186 | SEKRADHAN | India | 3 (85.25) | 3 (85) | 56.046875 | 10.715 |
187 | IR10C-157 | IRRI, Philippines | 3 (90.25) | 3 (88) | 60.846875 | 5.745 |
188 | GURUJIDHAN | India | 7 (80.25) | 5 (80) | 28.346875 | 9.925 |
189 | Lalat | Odisha, India | 7 (85.25) | 5 (85) | 26.746875 | 5.745 |
190 | KASALATH | Bangladesh | 3 (80.25) | 3 (80) | 60.446875 | 10.425 |
191 | Satyakrishna | Odisha, India | 7 (90.25) | 5 (80) | 16.146875 | 4.745 |
192 | Sahabhagi Dhan | Odisha, india | 1 (95.25) | 1 (90) | 65.846875 | 14.425 |
193 | Satabdi | West Bengal, India | 7 (95.25) | 7 (95) | 18.346875 | 3.085 |
194 | KUSUMA | Odisha, India | 3 (90.25) | 3 (90) | 46.146875 | 9.925 |
195 | Annapurna | Odisha, India | 5 (80.25) | 5 (80) | 22.846875 | 5.425 |
196 | Surendra | Odisha, India | 5 (85.25) | 5 (82) | 24.346875 | 4.945 |
197 | BASARAMATIA | India | 5 (75.25) | 3 (60) | 35.246875 | 5.565 |
198 | Birupa | Odisha, India | 5 (80.25) | 5 (70) | 27.946875 | 4.745 |
199 | Naveen | Odisha, India | 5 (90.25) | 5 (95) | 23.846875 | 5.755 |
200 | Bowdel | India | 1 (95.25) | 1 (90) | 68.046875 | 12.665 |
201 | IR 72 | IRRI, Phillippines | 5 (75.25) | 5 (75) | 31.246875 | 4.285 |
202 | LALSANKRI | India | 1 (90.25) | 1 (90) | 61.146875 | 11.365 |
203 | CR2340-2 | NRRI, Cuttack, India | 1 (98.25) | 1 (95) | 81.546875 | 10.315 |
204 | TEPIBORO | Assam, India | 1 (95.25) | 1 (95) | 44.246875 | 10.315 |
205 | BORI | India | 3 (90.25) | 3 (90) | 50.846875 | 9.925 |
206 | CR2340-1 | NRRI, Cuttack, India | 3 (75.25) | 1 (70) | 61.946875 | 11.625 |
207 | Vijetha | Andhra Pradesh, India | 7 (70.25) | 5 (75) | 26.946875 | 5.325 |
208 | SURJAMUKHI | India | 1 (95.25) | 1 (95) | 64.446875 | 12.955 |
209 | Divya | India | 5 (80.25) | 3 (85) | 29.146875 | 4.645 |
210 | Pusa 44 | Uttar Pradesh, India | 7 (85.25) | 5 (80) | 21.946875 | 3.275 |
211 | FULLKATI | India | 3 (85.25) | 3 (85) | 55.746875 | 9.685 |
212 | MENKASALA | India | 3 (90.25) | 3 (90) | 48.146875 | 10.385 |
213 | ADT 43 | Tamil Nadu, India | 7 (75.25) | 5 (80) | 23.046875 | 4.715 |
214 | CR2463-25 | NRRI, Cuttack | 5 (80.25) | 5 (90) | 27.746875 | 5.315 |
215 | Khitish | West Bengal, India | 5 (70.25) | 5 (70) | 23.346875 | 4.715 |
216 | Shaktiman | Odisha, India | 5 (67) | 5 (71) | 27.321875 | 5.035 |
217 | MURIDANRA | India | 3 (82) | 3 (71) | 49.121875 | 10.685 |
218 | BAILAM | Bangladesh | 3 (82) | 3 (83) | 54.121875 | 11.465 |
219 | Bhoi | Odisha, india | 7 (87) | 5 (81) | 23.021875 | 5.525 |
220 | RAISARIA | India | 3 (72) | 3 (76) | 53.421875 | 11.565 |
221 | Indira | Odisha, India | 5 (62) | 5 (66) | 24.721875 | 4.215 |
222 | Ratna | Odisha, India | 5 (67) | 5 (61) | 23.121875 | 5.285 |
223 | SERETY | Korea | 3 (87) | 3 (81) | 63.421875 | 12.565 |
224 | Konark | Odisha, India | 5 (77) | 5 (71) | 24.321875 | 5.415 |
225 | Prasad | India | 5 (67) | 5 (61) | 25.421875 | 6.415 |
226 | DV123 | IRRI, Philippines | 3 (77) | 3 (71) | 54.521875 | 11.865 |
227 | BORO 4005 | NRRI, Cuttack, India | 5 (87) | 5 (81) | 32.021875 | 5.045 |
228 | CR3813-4-4-4-2-2 | NRRI, Cuttack, India | 1 (82) | 1 (86) | 72.321875 | 11.425 |
229 | BG301 | Sri Lanka | 3 (77) | 3 (71) | 53.521875 | 11.765 |
230 | Jajati | Odisha, India | 7 (92) | 5 (71) | 22.021875 | 4.345 |
231 | Radhi | Odisha, India | 7 (82) | 5 (71) | 25.721875 | 5.375 |
232 | MANDRIRA | IRRI, Philippine | 3 (87) | 3 (81) | 61.621875 | 10.705 |
233 | Sravani | Odisha, India | 7 (92) | 5 (71) | 24.721875 | 5.485 |
234 | Sasyasree | Odisha, India | 7 (87) | 5 (71) | 23.821875 | 5.315 |
235 | Gajapati | Odisha, India | 7 (92) | 7 (91) | 20.321875 | 4.715 |
236 | Bhavani | Odisha, India | 7 (82) | 5 (66) | 29.721875 | 4.385 |
237 | CSR90 | Haryana, India | 5 (82) | 5 (86) | 24.321875 | 6.705 |
238 | IR 50 | IRRI, Philippines | 7 (92) | 7 (91) | 20.721875 | 4.415 |
239 | CR3820-4-5-5-3-1 | NRRI, Cuttack, India | 7 (82) | 5 (76) | 33.221875 | 5.485 |
240 | Tapaswini | Odisha, India | 7 (87) | 7 (81) | 20.421875 | 4.315 |
241 | YN1353-3 | IRRI, Philippines | 3 (87) | 3 (81) | 53.521875 | 10.525 |
242 | Ananga | Odisha, India | 7 (87) | 7 (81) | 21.121875 | 5.415 |
243 | Chandan | Odisha, india | 5 (87) | 3 (81) | 29.621875 | 6.415 |
244 | HABIGONJ BORO6 | Bangladesh | 3 (67) | 3 (56) | 65.121875 | 12.465 |
245 | CR3621-6-1-3-1-2 | NRRI, Cuttack, india | 3 (77) | 3 (81) | 49.321875 | 8.525 |
246 | Satabdi | West Bengal, Odisha | 7 (100) | 7 (99) | 20.821875 | 4.485 |
247 | BAMAWPYAN | IRRI, Philippine | 1 (92) | 1 (91) | 64.421875 | 11.765 |
248 | Kshira | Odisha, india | 7 (87) | 7 (81) | 19.021875 | 5.305 |
249 | CR 2461-9 | NRRI, Cuttack, india | 5 (92) | 3 (71) | 39.121875 | 7.415 |
250 | IR 8 | IRRI, Philippines | 7 (92) | 5 (76) | 21.921875 | 5.015 |
251 | Gouri | Odisha, India | 7 (97) | 7 (93) | 19.721875 | 4.745 |
252 | Vikramarya | India | 5 (77) | 5 (71) | 24.021875 | 5.615 |
253 | CR Dhan 208 | NRRI, Cuttack, India | 5 (77) | 3 (66) | 43.121875 | 8.815 |
254 | Luit | Assam, India | 5 (87) | 5 (91) | 22.821875 | 4.855 |
255 | CO 43 | Tamil Nadu, India | 7 (92) | 7 (91) | 16.821875 | 5.675 |
256 | Kalyani 2 | Odisha, India | 7 (77) | 5 (61) | 28.621875 | 8.785 |
257 | Kalakeri | Jharkhand, India | 3 (87) | 3 (86) | 67.721875 | 11.025 |
258 | Browngora | Jharkhand, India | 3 (94) | 3 (91) | 54.221875 | 10.525 |
259 | CR3825-2-1-2-2-4 | NRRI, Cuttack, India | 5 (74.5) | 5 (81) | 23.971875 | 5.3275 |
260 | Sneha | Odisha, India | 7 (91.5) | 7 (91) | 17.571875 | 4.3875 |
261 | Lalnakanda | India | 3 (84.5) | 1 (81) | 64.471875 | 10.7675 |
262 | LAXMIKAJAL | India | 3 (84.5) | 1 (86) | 52.971875 | 9.6675 |
263 | CR 143-2-2 | NRRI, Cuttack, India | 1 (94.5) | 1 (96) | 80.471875 | 12.3875 |
264 | WAB 56-50 | Africa | 5 (69.5) | 5 (76) | 26.371875 | 7.4475 |
265 | WITA 10 | Africa | 5 (64.5) | 5 (61) | 33.971875 | 7.3675 |
266 | Govind | Uttar Pradesh, India | 7 (84.5) | 5 (76) | 27.371875 | 5.3575 |
267 | KASARAKUNDA | India | 3 (74.5) | 3 (66) | 51.671875 | 10.7575 |
268 | CR Dhan 601 | Odisha, India | 5 (69.5) | 5 (76) | 42.271875 | 7.6675 |
269 | Rasi | Andhra Pradesh, India | 3 (79.5) | 3 (76) | 48.071875 | 9.4775 |
270 | CR3825-2-1-2-2-3 | NRRI, Cuttack, India | 5 (74.5) | 3 (71) | 34.971875 | 6.4675 |
271 | Jyothi | Kerala, India | 5 (74.5) | 3 (66) | 27.071875 | 4.6575 |
272 | Nidhi | Tamil Nadu, India | 7 (84.5) | 7 (81) | 16.971875 | 3.3575 |
273 | PUNEI | India | 3 (64.5) | 3 (61) | 41.671875 | 8.7975 |
274 | CR3820-4-5-3-1-3 | NRRI, Cuttack, India | 7 (89.5) | 7 (91) | 41.371875 | 3.3575 |
275 | ADT 45 | Tamil Nadu, India | 7 (84.5) | 5 (76) | 23.971875 | 5.6675 |
276 | DUMERPHULLI | India | 3 (74.5) | 3 (81) | 53.771875 | 11.5075 |
277 | Ratnagiri 3 | Maharashtra, India | 5 (79.5) | 5 (86) | 27.471875 | 6.4275 |
278 | Mahamaya | Chhattisgarh, India | 7 (74.5) | 5 (66) | 21.671875 | 5.7875 |
279 | LAHDIL | India | 3 (74.5) | 3 (71) | 48.171875 | 9.9775 |
280 | Kushal | India | 5 (59.5) | 5 (66) | 25.071875 | 6.4975 |
281 | CR3621-6-1-3-1-1 | NRRI, Cuttack, India | 5 (84.5) | 3 (83) | 34.071875 | 6.5575 |
282 | HAZARIDHAN | Jharkhand, India | 3 (89.5) | 3 (86) | 42.171875 | 8.6675 |
283 | CR3820-2-1-5-1-2 | NRRI, Cuttack, India | 5 (84.5) | 5 (81) | 25.271875 | 6.3475 |
284 | KALINGA II | Odisha, India | 5 (74.5) | 3 (71) | 39.171875 | 8.2675 |
285 | Bhadra | India | 5 (64.5) | 5 (66) | 28.771875 | 5.3475 |
286 | CR3826-8-3-2-1-1 | NRRI, Cuttack, India | 5 (74.5) | 5 (71) | 28.571875 | 7.3575 |
287 | Pant Dhan19 | Uttarakhand, India | 5 (74.5) | 5 (71) | 22.571875 | 5.7775 |
288 | Pant Dhan18 | Uttarakhand, India | 7 (79.5) | 5 (76) | 18.371875 | 4.9575 |
289 | ADT 47 | Tamil Nadu, India | 7 (89.5) | 5 (71) | 16.571875 | 5.2575 |
290 | Jawahar | India | 5 (64.5) | 5 (61) | 26.971875 | 5.7875 |
291 | Jaya | Andhra Pradesh, India | 7 (94.5) | 7 (96) | 19.471875 | 4.6675 |
292 | CR3622-7-3-2-2 | NRRI, Cuttack, India | 5 (84.5) | 5 (81) | 27.871875 | 6.4275 |
293 | CR3622-7-3-1-1 | NRRI, Cuttack, India | 5(74.5) | 5 (76) | 27.271875 | 6.9575 |
294 | JGL 1798 | Andhra Pradesh, India | 7 (84.5) | 5 (76) | 22.171875 | 4.4275 |
295 | IET 19879 | India | 7 (69.5) | 5 (76) | 21.771875 | 4.2275 |
296 | IET 19985 | India | 5 (79.50 | 5 (76) | 33.971875 | 7.1275 |
297 | IET 20538 | India | 5 (74.5) | 3 (76) | 37.971875 | 6.3175 |
298 | IET 20526 | India | 5 (69.5) | 5 (71) | 26.571875 | 5.7475 |
299 | PMK-2 | Tamil Nadu, India | 7 (64.5) | 7 (66) | 16.171875 | 3.6075 |
300 | TKM-11 | Tamil Nadu, India | 7 (79.5) | 7 (86) | 16.871875 | 3.9575 |
301 | IET 20532 | India | 3 (89.5) | 3 (89) | 63.771875 | 11.3875 |
302 | IET 20525 | India | 3 (85.25) | 3 (80.25) | 56.896875 | 11.26 |
303 | IET 20529 | India | 3 (80.25) | 3 (80.25) | 56.196875 | 11.44 |
304 | IET 20559 | India | 5 (75.25) | 3 (70.25) | 34.196875 | 5.77 |
305 | IET 20533 | India | 5 (70.25) | 3 (75.25) | 33.396875 | 6.53 |
306 | Udayagiri | Odisha, India | 5 (80.25) | 5 (85. 25) | 23.246875 | 6.41 |
307 | Sebati | Odisha, India | 7 (75.25) | 7 (70.25) | 18.196875 | 4.39 |
308 | Pavithra | Kerala, India | 7 (75.25) | 7 (70.25) | 18.896875 | 4.74 |
309 | Uma | Kerala, India | 7 (85.25) | 7 (80.25) | 16.116875 | 4.53 |
310 | Kairaly | Kerala, india | 7 (85.25) | 7 (85.25) | 16.916875 | 4.31 |
311 | IET 20540 | India | 3 (75.25) | 3 (75.25) | 52.496875 | 11.43 |
312 | IET 20534 | India | 5 (65.25) | 5 (70.25) | 31.596875 | 6.4 |
313 | IET 20545 | India | 3 (90.25) | 3 (85.25) | 55.396875 | 10.66 |
314 | IET 20556 | India | 5 (75.25) | 3 (70.25) | 28.496875 | 6.83 |
315 | IET 20557 | India | 3 (88.25) | 3 (85.25) | 53.796875 | 10.39 |
316 | IET 20535 | India | 5 (75.25) | 3 (65.25) | 38.596875 | 6.9 |
317 | Sidhanta | Odisha, india | 7 (90.25) | 7 (95.25) | 21.696875 | 4.5 |
318 | Bharani | Andhra Pradesh, India | 7 (80.25) | 7 (85.25) | 17.916875 | 4.74 |
319 | Co-47 | Tamil Nadu, India | 7 (80.25) | 7 (80.25) | 14.816875 | 3.04 |
320 | Jaldi dhan-13 | West Bengal, India | 5 (75.25) | 5 (70.25) | 30.796875 | 7.86 |
321 | GR-9 | Gujarat, India | 7 (85.25) | 7 (85.25) | 16.946875 | 3.82 |
322 | IET 20561 | India | 3 (75.25) | 3 (70.25) | 52.796875 | 9.07 |
323 | IET 20622 | India | 58 (80.25) | 3 (75.25) | 35.596875 | 6.64 |
324 | IET 20601 | India | 5 (78.25) | 3 (75.25) | 32.796875 | 6.86 |
325 | IET 20614 | India | 5 (85.25) | 3 (70.25) | 42.096875 | 6.53 |
326 | IET 19140 | India | 3 (80.25) | 3 (75.25) | 42.996875 | 10.74 |
327 | IET 19972 | India | 5 (85.25) | 5 (80.25) | 21.496875 | 7.5 |
328 | Heera | Odisha, India | 5 (75.25) | 3 (60.25) | 60.696875 | 11.04 |
329 | KalingaIII | Odisha, India | 5 (85.25) | 3 (80.25) | 27.396875 | 7.16 |
330 | Geetanjali | Odisha, India | 7 (95.25) | 7 (95.25) | 16.796875 | 3.9 |
331 | Kamesh | Jharkhand, India | 3 (75.25) | 3 (70.25) | 60.496875 | 7.54 |
332 | Parijat | Odisha, India | 5 (70.25) | 5 (70.25) | 23.796875 | 5.74 |
333 | Naveen | Odisha, India | 5 (65.25) | 5 (60.25) | 26.196875 | 6.53 |
334 | Sadavahar | Jharkhand, India | 5 (65.25) | 3 (70.25) | 42.796875 | 7.03 |
335 | Vanaprava | Odisha, India | 5 (85.25) | 3 (75.25) | 34.296875 | 6.7 |
336 | Abhisek | Jharkhand, India | 3 (85.25) | 3 (80.25) | 47.996875 | 10.5 |
337 | Anjali | Jharkhand, India | 3 (90.25) | 3 (95.25) | 58.796875 | 12.41 |
338 | Phalguni | Odisha, India | 7 (98.25) | 7 (98.25) | 23.996875 | 3.2 |
339 | Samaleswari | Chhattisgarh, India | 7 (95.25) | 7 (90.25) | 15.896875 | 3.63 |
340 | Phule Radha | Maharashtra, India | 7 (90.25) | 7 (95.25) | 17.096875 | 4.4 |
341 | Manaswini | Odisha, India | 7 (90.25) | 7 (88.25) | 19.096875 | 5.03 |
342 | Sahyadri-4 | Maharashtra, India | 7 (88.25) | 7 (85.25) | 21.096875 | 5.43 |
343 | RC Maniphou-6 | Manipur, India | 7 (80.25) | 7 (82.25) | 23.796875 | 6.33 |
344 | Karjat-7 | Maharashtra, India | 7 (82.25) | 7 (84.25) | 21.896875 | 5.98 |
345 | N22 (Tolerant check) | Uttar Pradesh, India | 1 (98) | 1 (98) | 83.225 | 13.24 |
346 | Dular (Tolerant check) | Odisha, India | 1 (94) | 1 (90) | 71.825 | 12.38 |
347 | IR64 (Susceptible check) | IRRI, Philippines | 7 (82) | 7 (80) | 9.13 | 1.85 |
348 | IR20 (Susceptible check) | IRRI, Philippines | 7 (95) | 7 (96) | 6.2 | 1.26 |
Control treatment means | Standard error of difference | 1.06346 | 0.75986 | 0.54420 | 0.19385 | |
Tukey's HSD at 5% | 8.6645 | 6.1909 | 4.4338 | 1.57938 | ||
Test treatment in the same block | Standard error of difference | 3.00793 | 2.14920 | 1.53922 | 0.54829 | |
Tukey's HSD at 5% | 24.5068 | 17.510 | 12.5407 | 4.46716 | ||
Test treatment not in the same block | Standard error of difference | 3.36296 | 2.40288 | 1.72090 | 0.61301 | |
Tukey's HSD at 5% | 27.3995 | 19.5772 | 14.0209 | 4.99444 | ||
Test treatment and a control treatment | Standard error of difference | 2.46554 | 1.76165 | 1.26167 | 0.44942 | |
Tukey's HSD at 5% | 20.08 | 14.3529 | 10.2793 | 3.66164 |
Name | Forward (5'-3') | Reverse (5'-3') | Gene | Reference |
---|---|---|---|---|
RM6089 | CCACCGAATCGAATAACCAC | ATGGCCAGCGTGATCTCC | Dro2 | Uga et al.(2013) |
ID07_14 | CCATGATCAAACCACACAGC | TGTCAGGGCACCATGACTTA | Dro1 | Uga et al.(2008) |
ID12_17 | ACCGTAGCGTTAGCATGGAC | ACTACGAGAATGCGGTGCTT | Dro1 | Uga et al.(2008) |
RM24393 | TAGCTGCTTAGCTTTGACTTGG | ATGTAATCCTACGAGGAGATCG | Dro1 | Uga et al. (2010) |
RM7424 | AGAAGCCCATCTAGCAGCAG | TCAAGCTAGCCACACAGCTG | Dro1 | Uga et al.(2010) |
SNP02-KP | GTCTAGATCACG-CAGTGAAT | TCGCATGATGATGACCAAGT | Dro1 | Uga et al.(2013) |
SNP02-IR64 | ATCGTCTAGATCACGCATGAAC | AGGGTGGCTTTACCTCCGTA | Dro1 | Uga et al.(2013) |
Dro1-CAPS5 | GCACAAGATGGGAGGAGAGT | CATGGGTGAGAATCGTGTTG | Dro1 | Uga et al.(2013) |
Dro1-INDEL | GCAGACGCTCGTAACACGTA | GT-GGCAGCTCCATCAACTCT | Dro1 | Uga et al.(2013) |
Supplemental Table 2. List of markers used in the study.
Name | Forward (5'-3') | Reverse (5'-3') | Gene | Reference |
---|---|---|---|---|
RM6089 | CCACCGAATCGAATAACCAC | ATGGCCAGCGTGATCTCC | Dro2 | Uga et al.(2013) |
ID07_14 | CCATGATCAAACCACACAGC | TGTCAGGGCACCATGACTTA | Dro1 | Uga et al.(2008) |
ID12_17 | ACCGTAGCGTTAGCATGGAC | ACTACGAGAATGCGGTGCTT | Dro1 | Uga et al.(2008) |
RM24393 | TAGCTGCTTAGCTTTGACTTGG | ATGTAATCCTACGAGGAGATCG | Dro1 | Uga et al. (2010) |
RM7424 | AGAAGCCCATCTAGCAGCAG | TCAAGCTAGCCACACAGCTG | Dro1 | Uga et al.(2010) |
SNP02-KP | GTCTAGATCACG-CAGTGAAT | TCGCATGATGATGACCAAGT | Dro1 | Uga et al.(2013) |
SNP02-IR64 | ATCGTCTAGATCACGCATGAAC | AGGGTGGCTTTACCTCCGTA | Dro1 | Uga et al.(2013) |
Dro1-CAPS5 | GCACAAGATGGGAGGAGAGT | CATGGGTGAGAATCGTGTTG | Dro1 | Uga et al.(2013) |
Dro1-INDEL | GCAGACGCTCGTAACACGTA | GT-GGCAGCTCCATCAACTCT | Dro1 | Uga et al.(2013) |
Fig. 1. Frequency distributions of leaf rolling, leaf drying, spikelet fertility and single plant yield among 348 genotypes under moderate drought stress.
Fig. 2. Representative pictures of gravitropic response of primary roots of Dro positive genotypes by using agarose-glass box method along with negative check IR64.A, KalingaIII. B, Lalsankari. C, Dular. D, N22. E, Kasalath. F-H, IR64.
Fig. 3. Frequency distribution of mean root angle of the panel population in response to gravitropic effect (A) and primary mean root angle of genotypes having both Dro1 and Dro2 along with negative check IR64 (B).
Supplemental Fig. 1 Representative electrophoregram obtained with ID07_14 showing target band of 174 bp. The numbers represent the genotypes listed in Table 2.
Supplemental Fig 2. Amplicons obtained with RM6089. The Orange arrow indicates the target allele in Dular (170bp) and the blue arrow indicates IR64 allele (165bp). The numbers represent the genotypes listed in Table 2.
Fig. 4. Graph of K value, an ad-hoc statistic related to the rate of change in the log probability of data between successive K values (A), and population structure of 101 germplasm lines based on membership probability fractions of individual genotypes (B) and population structure of 101 germplasm lines sorted based on serial number of the genotypes (C).
Fig. 5. Principal coordinate analysis (A) and unweighted pair group method arithmatic average (UPGMA) algorithm (B) obtained with the molecular markers for Dro1 and Dro2 loci of 101 genotypes. The dot numbers in the figure represent the serial number of the genotypes.
[1] | Barik S R, Pandit E, Pradhan S K, Singh S, Swain P, Mohapatra T. 2018. QTL mapping for relative water content trait at reproductive stage drought stress in rice. Ind J Genet, 78(4): 401-408. |
[2] | Barik S R, Pandit E, Pradhan S K, Mohanty S P, Mohapatra T. 2019. Genetic mapping of morpho-Physiological traits involved during reproductive stage drought tolerance in rice. PLoS One, 14(12): e0214979. |
[3] | Bernier J, Serraj R, Kumar A, Venuprasad R, Impa S, Gowdaa R P V, Oane R, Spaner D, Atlin G. 2009. The large-effect drought- resistance QTL qtl12.1 increases water uptake in upland rice. Field Crops Res, 110(2): 139-146. |
[4] | Chang T T, Loresto G C, Tagumpay O. 1974. Screening of rice germplasm for drought resistant. Sabrao J, 6(1): 9-16. |
[5] | Chin J H, Lu X C, Haefele S M, Gamuyao R, Ismail A, Wissuwa M, Heuer S. 2010. Development and application of gene-based markers for the major rice QTL phosphorus uptake 1. Theor Appl Genet, 120: 1073-1086. |
[6] | Chin J H, Gamuyao R, Dalid C, Bustamam M, Prasetiyono J, Moeljopawiro S, Wissuwa M, Heuer S. 2011. Developing rice with high yield under phosphorus deficiency: Pup1 sequence to application. Plant Physiol, 156(3): 1202-1216. |
[7] | Davatgar N, Neishabouri M R, Sepaskhah A R, Soltani A. 2009. Physiological and morphological responses of rice (Oryza sativa L.) to varying water stress management strategies. Int J Plant Prod, 3(4): 19-32. |
[8] | Earl D A, von Holdt B M. 2012. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv Genet Res, 4(2): 359-361. |
[9] | Evanno G, Regnaut S, Goudet J. 2005. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol Ecol, 14(8): 2611-2620. |
[10] | Farooq M, Kobayashi N, Ito O, Wahid A, Serraj R. 2010. Broader leaves result in better performance of indica rice under drought stress. J Plant Physiol, 167(13): 1066-1075. |
[11] | Fukai S, Cooper M. 1995. Development of drought resistant cultivars using physio-morphological traits in rice. Field Crops Res, 40(2): 67-86. |
[12] | Hsiao T C. 1973. Plant responses to water stress. Ann Rev Plant Physiol, 24: 519-570. |
[13] | Henry A, Gowda V R P, Torres R O, McNally K L, Serraj R. 2011. Variation in root system architecture and drought response in rice ( Oryza sativa): Phenotyping of the Oryza SNP panel in rainfed lowland fields. Field Crops Res, 120(2): 205-214. |
[14] | IRRI (International Rice Research Institute). 2013. SES (Standard Evaluation System for Rice). International Network for Genetic Evaluation of Rice. Los Baños, the Philippines: International Rice Research Institute. |
[15] | Kang Y H, Khan S, Ma X Y. 2009. Climate change impacts on crop yield, crop water productivity and food security: A review. Prog Nat Sci, 19: 1665-1674. |
[16] | Kato Y, Abe J, Kamoshita A. Yamagishi J. 2006. Genotypic variation in root growth angle in rice (Oryza sativa L.) and its association with deep root development in upland fields with different water regimes. Plant Soil, 287: 117-129. |
[17] | Kitomi Y, Kanno N, Kawai S, Mizubayashi T, Fukuoka S, Uga Y. 2015. QTLs underlying natural variation of root growth angle among rice cultivars with the same functional allele of deeper rooting. Rice, 18: 16. |
[18] | Kondo M, Murty M V R, Aragones D V. 2000. Characteristics of root growth and water uptake from soil in upland rice and maize under water stress. Soil Sci Plant Nutr, 46(3): 721-732. |
[19] | Kumar R, Sarawgi A K, Ramos C, Amarante S T, Ismail A M, Wade L J. 2006. Partioning of dry matter during drought stress in rainfed lowland rice. Field Crops Res, 96: 455-465. |
[20] | Kumar R, Sreenu K, Singh N, Jain N, Singh N K, Rai V. 2015. Effect of drought stress on contrasting cultivars of rice. Int J Trop Agric, 33(2): 1559-1564. |
[21] | McKersie B. 2015. Planning for food security in a changing climate. J Exp Bot, 66: 3435-3450. |
[22] | Pandit E, Sahoo A, Panda R K, Mohanty D P, Pani D R, Anandan A, Pradhan S K. 2016. Survey of rice cultivars and landraces of upland ecology for Phosphorous uptake 1 ( Pup1) QTL using linked and gene specific molecular markers. Oryza, 53(1): 1-9. |
[23] | Pandit E, Panda R K, Pani D R, Chandra R, Singh S, Pradhan S K. 2018. Molecular marker and phenotypic analyses for low phosphorus stress tolerance in cultivars and landraces of upland rice under irrigated and drought situations. Ind J Genet, 78(1): 59-68. |
[24] | Pennisi E. 2008. The blue revolution, drop by drop, gene by gene. Science, 320: 171-173. |
[25] | Perrier X, Jacquemoud-Collet J P. 2006. DARwin software. . |
[26] | Pradhan S K, Barik S R, Sahoo A, Mohapatra S, Nayak D K, Mahender A, Meher J, Anandan A, Pandit E. 2016. Population structure, genetic diversity and molecular marker-trait association analysis for high temperature stress tolerance in rice. PLoS One, 11(8): e0160027. |
[27] | Pritchard J K, Stephens M, Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics, 155(2): 945-959. |
[28] | Singh H, Mackill K T. 1991. Senstivity of rice to water deficit at different growth stages. Phil Crop Sci, 16: S11. |
[29] | Singh C S, Kumar B, Mehandi S, Chandra K. 2012. Effect of drought stress in rice: A review on morphological and physiological characteristics. Trends Biosci, 5(4): 261-265. |
[30] | Torres R O, Henry A. 2018. Yield stability of selected rice breeding lines and donors across conditions of mild to moderately severe drought stress. Field Crops Res, 220: 37-45. |
[31] | Uga Y, Okuno K, Yano M. 2011. Dro1, a major QTL involved in deep rooting of rice under upland field conditions. J Exp Bot, 62(8): 2485-2494. |
[32] | Uga Y, Hanzawa E, Nagai S, Sasaki K, Yano M, Sato T. 2012. Identification of qSOR1, a major rice QTL involved in soil- surface rooting in paddy fields. Theor Appl Genet, 124(1): 75-86. |
[33] | Uga Y, Sugimoto K, Ogawa S, Rane J, Ishitani M, Hara N, Kitomi Y, Inukai Y, Ono K, Kanno N, Inoue H, Takehisa H, MotoyamaR, Nagamura Y, Wu J, Matsumoto T, Takai T, Okuno K, Yano M. 2013a. Control of root system architecture by deeper rooting 1 increases rice yield under drought conditions. Nat Genet, 45(9): 1097-1102. |
[34] | Uga Y, Yamamoto E, Kanno N, Kawai S, Mizubayashi T, Fukuoka S. 2013b. A major QTL controlling deep rooting on rice chromosome 4. Sci Rep, 3: 3040. |
[35] | Wissuwa M, Noriharu A. 2001. Further characterization of two QTLs that increase phosphorous uptake of rice (Oryza sativa L.) under phosphorous deficiency. Plant Soil, 237(2): 275-286. |
[36] | Yang M Z, Xiao W H, Zhao Y, Li X D, Huang Y, Lu F, Hou B D, Li B Q. 2018. Assessment of potential climate change effects on the rice yield and water footprint in the Nanliujiang catchment, China. Sustainability, 10(2): 242. |
[37] | Yoshida S, Hasegawa S. 1982. The rice root system: Its development and function. In: Drought resistance in crops with emphasis on rice. Los Banos, the Philippines: International Rice Research Institute: 97-114. |
No related articles found! |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||