
Rice Science ›› 2021, Vol. 28 ›› Issue (5): 422-426.DOI: 10.1016/j.rsci.2021.07.002
• Letter • Previous Articles Next Articles
Zheng Zhou1,2,3, Liang Sun1, Wenbin Hu2, Bin Zhou2, Shuhua Tao2, Shihui Zhang2, Yanmei Lü2, Zhenghong Zhao2(
), Caiyan Chen1(
)
Received:2020-09-18
Accepted:2021-01-17
Online:2021-09-28
Published:2021-09-28
Zheng Zhou, Liang Sun, Wenbin Hu, Bin Zhou, Shuhua Tao, Shihui Zhang, Yanmei Lü, Zhenghong Zhao, Caiyan Chen. Breeding High-Grain Quality and Blast Resistant Rice Variety Using Combination of Traditional Breeding and Marker-Assisted Selection[J]. Rice Science, 2021, 28(5): 422-426.
Add to citation manager EndNote|Ris|BibTeX
| Marker | Gene | Type | Product size (bp) | Primer sequence (5'-3') | Reference |
|---|---|---|---|---|---|
| ZJ58.7 | Pigm | STS; co-dominant | 236 | F: ACTTGCTGGGAGAAGGATT | Yu et al, 2013 |
| R: AGTTCGTACTTTTCAGGCT | |||||
| PCR-AccI | Wx | CAPS; co-dominant | 460 | F: GCTTCACTTCTCTGCTTGTG | Liu et al, 2006 |
| R: ATGAT13"AACGAGAGTYGAA | |||||
| Mfgr | fgr | Allele-specific PCR; co-dominant | 167 206 | PlusF: ACAGGATTCAATCTTAAGAAACTTTATTGCCCT GGTAAAAAGATTATGGCTTCAG | |
| F:CTGGTATATATTTCAGCTGC | |||||
| R: GAATGATGCTCAAAGTGTC |
Table S1 Allelic associated markers employed in this study.
| Marker | Gene | Type | Product size (bp) | Primer sequence (5'-3') | Reference |
|---|---|---|---|---|---|
| ZJ58.7 | Pigm | STS; co-dominant | 236 | F: ACTTGCTGGGAGAAGGATT | Yu et al, 2013 |
| R: AGTTCGTACTTTTCAGGCT | |||||
| PCR-AccI | Wx | CAPS; co-dominant | 460 | F: GCTTCACTTCTCTGCTTGTG | Liu et al, 2006 |
| R: ATGAT13"AACGAGAGTYGAA | |||||
| Mfgr | fgr | Allele-specific PCR; co-dominant | 167 206 | PlusF: ACAGGATTCAATCTTAAGAAACTTTATTGCCCT GGTAAAAAGATTATGGCTTCAG | |
| F:CTGGTATATATTTCAGCTGC | |||||
| R: GAATGATGCTCAAAGTGTC |
| Variety | Functional allele | Blast resistance rating | Amylose content (%) | Fragrance | ||
|---|---|---|---|---|---|---|
| Pigm | OsBadh2 | Waxy | ||||
| Xiangwanxian 17 | pigm | fgr | Wxb | 9 | 14.8 | + |
| Gumei | Pigm | OsBadh2 | Wxa | 2 | 20.4 | - |
Table S2 Phenotypic and allelic differences for blast resistance, amylose content and grain fragrance.
| Variety | Functional allele | Blast resistance rating | Amylose content (%) | Fragrance | ||
|---|---|---|---|---|---|---|
| Pigm | OsBadh2 | Waxy | ||||
| Xiangwanxian 17 | pigm | fgr | Wxb | 9 | 14.8 | + |
| Gumei | Pigm | OsBadh2 | Wxa | 2 | 20.4 | - |
| Inbred line | Seedling blast rating a | Neck blast rating a | Blast resistance |
|---|---|---|---|
| BC2F5-CS12 | 2 | 3 | Resistant |
| BC2F5-CS17 | 2 | 3 | Resistant |
| BC2F5-CS21 | 3 | 6 | Susceptible |
| BC2F5-CS22 | 3 | 3 | Resistant |
| BC2F5-CS42 | 1 | 2 | Resistant |
| BC2F5-CS53 | 2 | 3 | Resistant |
| BC2F5-CS67 | 2 | 3 | Resistant |
| BC2F5-CS69 | 2 | 3 | Resistant |
| BC2F5-CS95 | 3 | 5 | Susceptible |
| Xiangwanxian 17 | 9 | 7 | Susceptible |
| Gumei 4 | 2 | 3 | Resistant |
| CO39 (CK) | 9 | 9 | Susceptible |
Table S3 Seedling and neck rice blast disease ratings for nine inbred lines under natural disease inoculation conditions.
| Inbred line | Seedling blast rating a | Neck blast rating a | Blast resistance |
|---|---|---|---|
| BC2F5-CS12 | 2 | 3 | Resistant |
| BC2F5-CS17 | 2 | 3 | Resistant |
| BC2F5-CS21 | 3 | 6 | Susceptible |
| BC2F5-CS22 | 3 | 3 | Resistant |
| BC2F5-CS42 | 1 | 2 | Resistant |
| BC2F5-CS53 | 2 | 3 | Resistant |
| BC2F5-CS67 | 2 | 3 | Resistant |
| BC2F5-CS69 | 2 | 3 | Resistant |
| BC2F5-CS95 | 3 | 5 | Susceptible |
| Xiangwanxian 17 | 9 | 7 | Susceptible |
| Gumei 4 | 2 | 3 | Resistant |
| CO39 (CK) | 9 | 9 | Susceptible |
Fig. S1. Development of allele-specific marker.A, Gene structure of OsBadh2 showing the polymorphic 8-bp deletion and three SNPs in the XWX17 allele compared to the sequences of Nipponbare (NPB) and GM4 alleles. B, Schematic diagram showing the development of the allele-specific (Mfgr) for fgr. C and D, Verification of AS-PCR marker for grain fragrance in 30 rice accessions by electrophoresis on 3% agarose gels. M, Marker; Lanes 1 to 30 indicate Nipponbare, R9311, GM4, Shuhui 527, Yuejingsimiao 2, Yuewangsimiao, Yueqisimiao, Teqing, IR64, R900, Huazhan, Jinsui 128, Huanghuazhan, Daohuaxiang 2, Xiangyaxiangzhen, Yueyou 9113, Nongxiang 18, Dalixiang, Tianyouhuazhan, Jigeng 88, Dongdao 2, Xiangwanxian 13, Xiangwanxian 17, Nongxiang 24, Nongxiang 32, Taoyouxiangzhan, Xiangwanxian 12, Yuzhenxiang, Y Liangyou 1 and R1128, respectively.
| No. | Rice accession | Type | Genotype of fgr marker | Phenotype of organ | |
|---|---|---|---|---|---|
| Leaf | Grain | ||||
| 1 | Nipponbare | Inbred | -/- | Non-fragrant | Non-fragrant |
| 2 | 9311 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 3 | GM4 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 4 | Shuhui 527 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 5 | Yuejingsimiao 2 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 6 | Yuewangsimiao | Inbred | -/- | Non-fragrant | Non-fragrant |
| 7 | Yueqisimiao | Inbred | -/- | Non-fragrant | Non-fragrant |
| 8 | Teqing | Inbred | -/- | Non-fragrant | Non-fragrant |
| 9 | IR64 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 10 | R900 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 11 | Huazhan | Inbred | -/- | Non-fragrant | Non-fragrant |
| 12 | Jinsui 128 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 13 | Huanghuazhan | Inbred | -/- | Non-fragrant | Non-fragrant |
| 14 | Daohuaxiang 2 | Inbred | +/+ | Fragrant | Fragrant |
| 15 | Xiangyaxiangzhen | Inbred | +/+ | Fragrant | Fragrant |
| 16 | Yueyou 9113 | Three-line hybird | -/- | Non-fragrant | Non-fragrant |
| 17 | Nongxiang 18 | Inbred | +/+ | Fragrant | Fragrant |
| 18 | Dalixiang | Inbred | +/+ | Fragrant | Fragrant |
| 19 | Tianyouhuazhan | Three-line hybird | -/- | Non-fragrant | Non-fragrant |
| 20 | Jigeng 88 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 21 | Dongdao 2 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 22 | Xiangwanxian 13 | Inbred | +/+ | Fragrant | Fragrant |
| 23 | Xiangwanxian 17 | Inbred | +/+ | Fragrant | Fragrant |
| 24 | Nongxiang 24 | Inbred | +/+ | Fragrant | Fragrant |
| 25 | Nongxiang 32 | Inbred | +/+ | Fragrant | Fragrant |
| 26 | Taoyouxiangzhan | Three-line hybird | +/- | Non-fragrant | Some fragrant |
| 27 | Xiangwanxian 12 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 28 | Yuzhenxiang | Inbred | +/+ | Fragrant | Fragrant |
| 29 | Y Liangyou 1 | Two-line hybird | -/- | Non-fragrant | Non-fragrant |
| 30 | R1128 | Inbred | -/- | Non-fragrant | Non-fragrant |
Table S4 Fragrance and Mfgr genotype of 30 rice varieties.
| No. | Rice accession | Type | Genotype of fgr marker | Phenotype of organ | |
|---|---|---|---|---|---|
| Leaf | Grain | ||||
| 1 | Nipponbare | Inbred | -/- | Non-fragrant | Non-fragrant |
| 2 | 9311 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 3 | GM4 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 4 | Shuhui 527 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 5 | Yuejingsimiao 2 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 6 | Yuewangsimiao | Inbred | -/- | Non-fragrant | Non-fragrant |
| 7 | Yueqisimiao | Inbred | -/- | Non-fragrant | Non-fragrant |
| 8 | Teqing | Inbred | -/- | Non-fragrant | Non-fragrant |
| 9 | IR64 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 10 | R900 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 11 | Huazhan | Inbred | -/- | Non-fragrant | Non-fragrant |
| 12 | Jinsui 128 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 13 | Huanghuazhan | Inbred | -/- | Non-fragrant | Non-fragrant |
| 14 | Daohuaxiang 2 | Inbred | +/+ | Fragrant | Fragrant |
| 15 | Xiangyaxiangzhen | Inbred | +/+ | Fragrant | Fragrant |
| 16 | Yueyou 9113 | Three-line hybird | -/- | Non-fragrant | Non-fragrant |
| 17 | Nongxiang 18 | Inbred | +/+ | Fragrant | Fragrant |
| 18 | Dalixiang | Inbred | +/+ | Fragrant | Fragrant |
| 19 | Tianyouhuazhan | Three-line hybird | -/- | Non-fragrant | Non-fragrant |
| 20 | Jigeng 88 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 21 | Dongdao 2 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 22 | Xiangwanxian 13 | Inbred | +/+ | Fragrant | Fragrant |
| 23 | Xiangwanxian 17 | Inbred | +/+ | Fragrant | Fragrant |
| 24 | Nongxiang 24 | Inbred | +/+ | Fragrant | Fragrant |
| 25 | Nongxiang 32 | Inbred | +/+ | Fragrant | Fragrant |
| 26 | Taoyouxiangzhan | Three-line hybird | +/- | Non-fragrant | Some fragrant |
| 27 | Xiangwanxian 12 | Inbred | -/- | Non-fragrant | Non-fragrant |
| 28 | Yuzhenxiang | Inbred | +/+ | Fragrant | Fragrant |
| 29 | Y Liangyou 1 | Two-line hybird | -/- | Non-fragrant | Non-fragrant |
| 30 | R1128 | Inbred | -/- | Non-fragrant | Non-fragrant |
Fig. S2. Breeding strategy for developing rice inbred lines with high grain quality, yield and rice blast resistance. CS, Changsha; SY, Sanya; MAS, Marker-assisted selection; XWX17, Xiangwanxian 17.
| Isolate | Race | Rice variety or line | |||||
|---|---|---|---|---|---|---|---|
| CO39 | GM4 | XWX17 | BC2F5-CS42 | BC2F5-CS53 | BC2F5-CS67 | ||
| 16-116 | ZC15 | S | R | S | R | R | R |
| 16-117 | ZC15 | S | R | S | R | R | R |
| 16-118 | ZB23 | S | R | S | R | S | R |
| 16-119 | ZA13 | S | R | S | R | R | R |
| 16-121 | ZB13 | S | R | S | R | R | R |
| 16-242 | ZG1 | S | R | S | R | S | R |
| 16-317 | ZC13 | S | R | S | R | R | S |
| 16-500 | ZB29 | S | R | S | R | R | R |
| 16-520 | ZB15 | S | R | S | R | S | S |
| 16-532 | ZG1 | S | R | S | R | R | R |
| 16-553 | ZC15 | S | R | S | R | R | R |
| 16-558 | ZC15 | S | R | S | R | S | R |
| 16-564 | ZG1 | S | R | S | S | R | R |
| 16-568 | ZC7 | S | R | S | R | R | S |
| 16-572 | ZA47 | S | R | S | R | R | R |
| 16-581 | ZB13 | S | R | S | R | R | R |
| 23 | ZB7 | S | R | S | R | S | R |
| 52 | ZA5 | S | R | S | S | R | S |
| 62 | ZB1 | S | R | S | R | R | R |
| 145 | ZB13 | S | R | S | R | R | R |
| Resistance spectrum (%) | 0.0 | 100.0 | 0.0 | 90.0 | 75.0 | 80.0 | |
Table S5 Seedling blast resistance for inbred lines BC2F5-CS42, BC2F5-CS53 and BC2F5-CS67 under artificial inoculation.
| Isolate | Race | Rice variety or line | |||||
|---|---|---|---|---|---|---|---|
| CO39 | GM4 | XWX17 | BC2F5-CS42 | BC2F5-CS53 | BC2F5-CS67 | ||
| 16-116 | ZC15 | S | R | S | R | R | R |
| 16-117 | ZC15 | S | R | S | R | R | R |
| 16-118 | ZB23 | S | R | S | R | S | R |
| 16-119 | ZA13 | S | R | S | R | R | R |
| 16-121 | ZB13 | S | R | S | R | R | R |
| 16-242 | ZG1 | S | R | S | R | S | R |
| 16-317 | ZC13 | S | R | S | R | R | S |
| 16-500 | ZB29 | S | R | S | R | R | R |
| 16-520 | ZB15 | S | R | S | R | S | S |
| 16-532 | ZG1 | S | R | S | R | R | R |
| 16-553 | ZC15 | S | R | S | R | R | R |
| 16-558 | ZC15 | S | R | S | R | S | R |
| 16-564 | ZG1 | S | R | S | S | R | R |
| 16-568 | ZC7 | S | R | S | R | R | S |
| 16-572 | ZA47 | S | R | S | R | R | R |
| 16-581 | ZB13 | S | R | S | R | R | R |
| 23 | ZB7 | S | R | S | R | S | R |
| 52 | ZA5 | S | R | S | S | R | S |
| 62 | ZB1 | S | R | S | R | R | R |
| 145 | ZB13 | S | R | S | R | R | R |
| Resistance spectrum (%) | 0.0 | 100.0 | 0.0 | 90.0 | 75.0 | 80.0 | |
Fig. S3. Comparisons of agronomic traits in three inbred lines against recurrent parent Xiangwanxian 17 (XWX17).* and ** represent significant differences at the 0.05 and 0.01 levels, respectively.
| Indicator | 2018 | 2019 | ||||
|---|---|---|---|---|---|---|
| Nongxiang 42 | Tianyouhuazhan | Nongxiang 42 | Tianyouhuazhan | |||
| Yield per hectare (kg) | 8251.5 | 9525.6 | 9099.3 | 10670.0 | ||
| Whole growth duration (d) | 118.5 | 120.3 | 116.6 | 119.9 | ||
| Effective panicles (×104 per hectare) | 329.0 | 332.6 | 308.1 | 325.5 | ||
| Total number of grains per panicle | 134.4 | 157.1 | 159.6 | 178.4 | ||
| Number of grains per panicle | 109.5 | 127.5 | 140.9 | 141.9 | ||
| Seed-setting rate (%) | 81.6 | 81.8 | 88.3 | 79.7 | ||
| 1000-grain weight (g) | 26.5 | 26.1 | 25.8 | 24.3 | ||
| Plant height (cm) | 111.8 | 111.2 | 111.8 | 110.4 | ||
| Brown rice rate (%) | 76.5 | 77.0 | 79.8 | - | ||
| Milled rice rate (%) | 67.1 | 66.5 | 70.9 | - | ||
| Head rice rate (%) | 40.0 | 56.4 | 58.3 | - | ||
| Grain length (mm) | 7.4 | 6.7 | 7.6 | - | ||
| Grain length-width ratio | 3.9 | 3.2 | 4.0 | - | ||
| Chalkiness rate (%) | 5.0 | 13.0 | 2.0 | - | ||
| Apparent amylose content (%) | 17.4 | 18.6 | 16.4 | - | ||
| Gel consistency (mm) | 70.0 | 50.0 | 60.0 | - | ||
| Alkali spreading value | 6.0 | 5.0 | 7.0 | - | ||
| Transparency (whiteness) | 2.0 | 1.0 | 1.0 | - | ||
| Moisture content (%) | 13.3 | 12.9 | 13.3 | - | ||
| Integrated rice blast resistance index | 4.1 | 8.3 (Xiangwanxian 11) | 3.8 | - | ||
Table S6 Agronomic trait performances of Nongxiang42 and its control (Tianyouhuazhan) in rice variety regional trials in 2018 and 2019.
| Indicator | 2018 | 2019 | ||||
|---|---|---|---|---|---|---|
| Nongxiang 42 | Tianyouhuazhan | Nongxiang 42 | Tianyouhuazhan | |||
| Yield per hectare (kg) | 8251.5 | 9525.6 | 9099.3 | 10670.0 | ||
| Whole growth duration (d) | 118.5 | 120.3 | 116.6 | 119.9 | ||
| Effective panicles (×104 per hectare) | 329.0 | 332.6 | 308.1 | 325.5 | ||
| Total number of grains per panicle | 134.4 | 157.1 | 159.6 | 178.4 | ||
| Number of grains per panicle | 109.5 | 127.5 | 140.9 | 141.9 | ||
| Seed-setting rate (%) | 81.6 | 81.8 | 88.3 | 79.7 | ||
| 1000-grain weight (g) | 26.5 | 26.1 | 25.8 | 24.3 | ||
| Plant height (cm) | 111.8 | 111.2 | 111.8 | 110.4 | ||
| Brown rice rate (%) | 76.5 | 77.0 | 79.8 | - | ||
| Milled rice rate (%) | 67.1 | 66.5 | 70.9 | - | ||
| Head rice rate (%) | 40.0 | 56.4 | 58.3 | - | ||
| Grain length (mm) | 7.4 | 6.7 | 7.6 | - | ||
| Grain length-width ratio | 3.9 | 3.2 | 4.0 | - | ||
| Chalkiness rate (%) | 5.0 | 13.0 | 2.0 | - | ||
| Apparent amylose content (%) | 17.4 | 18.6 | 16.4 | - | ||
| Gel consistency (mm) | 70.0 | 50.0 | 60.0 | - | ||
| Alkali spreading value | 6.0 | 5.0 | 7.0 | - | ||
| Transparency (whiteness) | 2.0 | 1.0 | 1.0 | - | ||
| Moisture content (%) | 13.3 | 12.9 | 13.3 | - | ||
| Integrated rice blast resistance index | 4.1 | 8.3 (Xiangwanxian 11) | 3.8 | - | ||
Fig. 1. Integrating marker-assisted selection with traditional breeding experience to breed novel fragrant rice variety, Nongxiang 42, with high eating and cooking quality and broad-spectrum rice blast resistance.A, Genotyping three desired alleles in Xiangwanxian 17 (XWX17), Gumei 4 (GM4) and three developed inbred lines. B, Comparison of rice grain appearance between XWX17 and Nongxiang 42. C, Leaf blast disease resistance comparison in CO39, Nongxiang 42, XWX17 and GM4. D and E, Field performance of Nongxiang 42 and XWX17, respectively. F, Graphical genotyping of the genetic background of Nongxiang 42 using 48 simple sequence repeat markers. Chr, Chromosome.
| [1] | Ashkani S, Rafii M Y, Shabanimofrad M, Miah G, Sahebi M, Azizi P, Tanweer F A, Akhtar M S, Nasehi A. 2015. Molecular breeding strategy and challenges towards improvement of blast disease resistance in rice crop. Front Plant Sci, 6: 886. |
| [2] | Ayres N M, McClung A M, Larkin P D, Bligh H F J, Jones C A, Park W D. 1997. Microsatellites and a single-nucleotide polymorphism differentiate apparent amylose classes in an extended pedigree of US rice germplasm. Theor Appl Genet, 94: 773-781. |
| [3] | Bradbury L M T, Fitzgerald T L, Henry R J, Jin Q S, Waters D L E. 2005. The gene for fragrance in rice. Plant Biotechnol J, 3(3): 363-370. |
| [4] | Chen Q H, Zeng G, Hao M, Jiang H Y, Xiao Y H. 2020. Improvement of rice blast and brown planthopper resistance of PTGMS line C815S in two-line hybrid rice through marker- assisted selection. Mol Breeding, 40(2): 21. |
| [5] | Chen Y L, Pang Y H, Bao J S. 2020. Expression profiles and protein complexes of starch biosynthetic enzymes from white- core and waxy mutants induced from high amylose indica rice. Rice Sci, 27(2): 152-161. |
| [6] | Cheng S H, Cao L Y, Zhuang J Y, Chen S G, Zhang X D, Fan Y Y, Zhu D F, Min S K. 2007. Super hybrid rice breeding in China: Achievements and prospects. J Integr Plant Biol, 49(6): 805-810. |
| [7] | Dai X J, He C, Zhou L, Liang M Z, Fu X C, Qin P, Yang Y Z, Chen L B. 2018. Identification of a specific molecular marker for the rice blast-resistant gene Pigm and molecular breeding of thermo-sensitive genic male sterile leaf-color marker lines. Mol Breeding, 38: 72. |
| [8] | Deng Y W, Zhu X D, Shen Y, He Z H. 2006. Genetic characterization and fine mapping of the blast resistance locus Pigm(t) tightly linked to Pi2 and Pi9 in a broad-spectrum resistant Chinese variety. Theor Appl Genet, 113(4): 705-713. |
| [9] | Deng Y W, Zhai K R, Xie Z, Yang D Y, Zhu X D, Liu J Z, Wang X, Qin P, Yang Y Z, Zhang G M, Li Q, Zhang J F, Wu S Q, Milazzo J, Mao B Z, Wang E T, Xie H A, Tharreau D, He Z H. 2017. Epigenetic regulation of antagonistic receptors confers rice blast resistance with yield balance. Science, 335: 962-965. |
| [10] | Dobo M, Ayres N, Walker G, Park W D. 2010. Polymorphism in the GBSS gene affects amylose content in US and European rice germplasm. J Cereal Sci, 52(3): 450-456. |
| [11] | He Q, Park Y J. 2015. Discovery of a novel fragrant allele and development of functional markers for fragrance in rice. Mol Breeding, 35(11): 217. |
| [12] | He Y, Han Y P, Jiang L, Xu C W, Lu J F, Xu M L. 2006. Functional analysis of starch-synthesis genes in determining rice eating and cooking qualities. Mol Breeding, 18(4): 277-290. |
| [13] | Hori K, Suzuki K, Iijima K, Ebana K. 2016. Variation in cooking and eating quality traits in Japanese rice germplasm accessions. Breeding Sci, 66(2): 309-318. |
| [14] | Isshiki M, Morino K, Nakajima M, Okagaki R J, Wessler S R, Izawa T, Shimamoto K. 1998. A naturally occurring functional allele of the rice waxy locus has a GT to TT mutation at the 5 ' splice site of the first intron. Plant J, 15(1): 133-138. |
| [15] | IRRI.2002. Standard Evaluation System for Rice (SES). Los Banos, the Phillippines: International Rice Research Institute: 11-30. |
| [16] | Jin L, Lu Y, Shao Y F, Zhang G, Xiao P, Shen S Q, Corke H, Bao J S. 2009. Molecular marker assisted selection for improvement of the eating, cooking and sensory quality of rice (Oryza sativa L.). J Cereal Sci, 51(1): 159-164. |
| [17] | Khush G S. 2005. What it will take to feed 5.0 billion rice consumers in 2030. Plant Mol Biol, 59(1): 1-6. |
| [18] | Lau W C P, Latif M A, Rafii M Y, Ismail M R, Puteh A. 2016. Advances to improve the eating and cooking qualities of rice by marker-assisted breeding. Crit Rev Biotechnol, 36(1): 87-98. |
| [19] | Liu A Q, Liang F J, Wang P R, Deng X J. 2006. Relationship between PCR-AccI marker of Wx gene and amylose content of rice and its application in improving rice quality. Chin J Appl Environ Biol, 12(3): 318‒321. (in Chinese with English abstract) |
| [20] | Liu Q Q, Li Q F, Cai X L, Wang H M, Tang S Z, Yu H X, Wang Z Y, Gu M H. 2006. Molecular marker-assisted selection for improved cooking and eating quality of two elite parents of hybrid rice. Crop Sci, 46(6): 2354-2360. |
| [21] | Luo W L, Guo T, Yang Q Y, Wang H, Liu Y Z, Zhu X Y, Chen Z Q. 2014. Stacking of five favorable alleles for amylase content, fragrance and disease resistance into elite lines in rice (Oryza sativa) by using four HRM-based markers and a linked gel- based marker. Mol Breeding, 34(3): 805-815. |
| [22] | Shao G N, Tang A, Tang S Q, Luo J, Jiao G A, Wu J L, Hu P S. 2011. A new deletion mutation of fragrant gene and the development of three molecular markers for fragrance in rice. Plant Breeding, 130(2): 172-176. |
| [23] | Shi W W, Yang Y, Chen S H, Xu M L. 2008. Discovery of a new fragrance allele and the development of functional markers for the breeding of fragrant rice varieties. Mol Breeding, 22(2): 185-192. |
| [24] | Sun L, Xu X X, Jiang Y R, Zhu Q H, Yang F, Zhou J Q, Yang Y Z, Huang Z Y, Li A H, Chen L H, Tang W B, Zhang G Y, Wang J R, Xiao G Y, Huang D Y, Chen C Y. 2016. Genetic diversity, rather than cultivar type, determines relative grain Cd accumulation in hybrid rice. Front Plant Sci, 7: 1407. |
| [25] | Suwannaporn P, Linnemann A. 2008. Rice-eating quality among consumers in different rice grain preference countries. J Sens Stud, 23(1): 1-13. |
| [26] | Tian Z X, Qian Q, Liu Q Q, Yan M X, Liu X F, Yan C J, Liu G F, Gao Z Y, Tang S Z, Zeng D L, Wang Y H, Yu J M, Gu M H, Li J Y. 2009. Allelic diversities in rice starch biosynthesis lead to a diverse array of rice eating and cooking qualities. Proc Natl Acad Sci USA, 106: 21760-21765. |
| [27] | Tilman D, Balzer C, Hill J, Befort B L. 2011. Global food demand and the sustainable intensification of agriculture. Proc Natl Acad Sci USA, 108: 20260-20264. |
| [28] | Wanchana S, Toojinda T, Tragoonrung S, Vanavichit A. 2003. Duplicated coding sequence in the waxy allele of tropical glutinous rice (Oryza sativa L.). Plant Sci, 165(6): 1193-1199. |
| [29] | Yao S, Zhang Y D, Liu Y Q, Zhao C F, Zhou L H, Chen T, Zhao Q Y, Zhu Z, Pillay B, Wang C L. 2020. Allelic effects on eating and cooking quality of SSIIa and PUL genes under Wxmp background in rice. Chin J Rice Sci, 34(3): 217-227. (in Chinese with English abstract) |
| [30] | Yu M M, Dai Z Y, Pan C H, Chen X J, Yu L, Zhang X X, Li Y H, Xiao N, Gong H B, Shen S L, Pan X B, Zhang H X, Li A H. 2013. Resistance spectrum difference between two broad-spectrum blast resisitance genes Pigm and Pi2 and their interaction effect on Pi1. Acta Agron Sin, 39(11): 1927‒1934. (in Chinese with English abstract) |
| [31] | Yu S B, Ali J, Zhang C P, Li Z K, Zhang Q F. 2020. Genomic breeding of green super rice varieties and their deployment in Asia and Africa. Theor Appl Genet, 133: 1427-1442. |
| [32] | Zeng D L, Tian Z X, Rao Y C, Dong G J, Yang Y L, Huang L C, Leng Y J, Xu J, Sun C, Zhang G H, Hu J, Zhu L, Gao Z Y, Hu X M, Guo L B, Xiong G S, Wang Y H, Li J Y, Qian Q. 2017. Rational design of high-yield and superior-quality rice. Nat Plants, 3(4): 17031. |
| [33] | Zhang C Q, Zhu J H, Chen S C, Fan X L, Li Q F, Lu Y, Wang M, Yu H X, Yi C D, Tang S Z, Gu M H, Liu Q Q. 2019. Wxlv, the ancestral allele of rice waxy gene. Mol Plant, 12(8): 1157-1166. |
| [34] | Zhang Q F. 2007. Strategies for developing green super rice. Proc Natl Acad Sci USA, 104: 16402-16409. |
| No related articles found! |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||