Cloning and Characterization of karmoisin Homologue Gene (Nlka) in Two Brown Planthopper Strains with Different Eye Colors

doi:doi.org/10.1016/j.rsci.2016.02.005

摘要/Abstract

关键词: Nilaparvata lugens, red-eye mutant, karmoisin, monocarboxylate transporter, phenoxazinone synthetase, rice, gene clone

. [J]. Rice Science, 2016, 23(2): 104-110.

图/表 6

Table 1 Oligonucleotide primers used for reverse transcription polymerase chain reaction (RT-PCR), rapid amplification of cDNA ends (RACE) and quantitative real-time PCR (qRT-PCR).

Primer	Sequence (5′-3′)	Description
ka-F1	ATGTCGGAAACCGAGAAAGTGC	RT-PCR
ka-R1	GAACAAACAGAGGCAGGGATGC
ka-F2	GTCCGATTGCGTTCGACTTGTG	3′-RACE
ka-R2	CTCCGCTGCAACTCCACATAGACC	5′-RACE
ka-F3	GGTCCGATTGCGTTCGACTTGTG	qRT-PCR
ka-R3	TGGATGAGTTGCGAGGTGGCTGT
β-actin F	ACGCCATCCTCCGTCTGGACTT
β-actin R	CAAAGTCCAGGGCAACGTAGCA

Fig. 1. cDNA sequences and deduced amino acid sequences of Nlka in N. lugens.The stop codon is indicated by an asterisk. The amino acids in boxes indicate the 11 predicted transmembrane domains.

Fig. 2. Genomic structure of the Nlka gene in N. lugens. Red boxes indicate the exons (1-7), and the spaces between two boxes indicate the introns (I-VI).

Fig. 3. Analysis of deduced amino acids of Nlka and karmoisin and monocarboxylate transporter (MCT) genes in other insects. A, Amino acid sequence alignments; B, Phylogenetic relationship analysis. Nlka, Nilaparvata lugens, KT304312; Dbka, Drosophila busckii, ALC46387.1; Dmka, Drosophila melanogaster, NP_001189213; Dpka, Danaus plexippus, EHJ77874.1; CbMCT, Cerapachys biroi, EZA53034; CfMCT, Camponotus floridanus, EFN65757; CqMCT, Culex quinquefasciatus, XP_001857555; HlMCT, Habropoda laboriosa, KOC69627; ZnMCT, Zootermopsis nevadensis, KDR23400.

Fig. 4. mRNA expression characters of Nlka in different tissues and development stages of brown planthopper. A, Reverse transcription PCR amplification of Nlka from total RNA in N. lugens; B, Relative mRNA expression levels at different developmental stages.Bw, Body wall; Ov, Ovary; Fb, Fat body; Mg, Midgut; Mt, Malpighian tubule; 1st, The first instar nymphs; 3rd, The third instar nymphs; 5th, The fifth instar nymphs; F, Female adults; M, Male adults.The relative expression level (fold) was expressed as mean ± SE (n = 3). Different lowercase letters above the columns indicate the significant differences at the 0.05 level.

Fig. 5. Relative expression levels of Nlka in red-eye mutant and brown-eye wild individuals at different developmental stages.1st, The first instar nymphs; 3rd, The third instar nymphs; 5th, The fifth instar nymphs; F, Female adults; M, Male adults; NIL-BB, Brown-eye wild type; NIL-rr, Red-eye mutant type.The relative expression level (fold) was expressed as mean ± SE (n = 4). Asterisk above the column indicates the significant difference at the 0.05 level.

参考文献 30

[1]	Beadle G W, Ephrussi B.1936. Development of eye colors in Drosophila: Transplantation experiments with suppressor of vermilion.Proc Natl Acad Sci USA, 22(9): 536-540.
[2]	Beard C B, Benedict M Q, Primus J P, Finnerty V, Collins F H.1995. Eye pigments in wild-type and eye-color mutant strains of the African malaria vector Anopheles gambiae.J Hered, 86(5): 375-380.
[3]	Challoner C M, Gooding R H.1997. A white eye color mutant in the tsetse fly Glossina morsitans submorsitans Newstead (Diptera: Glossinidae).Genome, 40: 165-169.
[4]	Cheng J A.2009. Rice planthopper problems and relevant causes in China. In: Heong K, Hardy B. Planthoppers: New Threats to the Sustainability of Intensive Rice Production Systems in Asia. Los Baños, the Philippines: International Rice Research Institute: 157-178.
[5]	Colinet D, Kremmer L, Lemauf S, Rebuf C, Gatti J L, Poirie M.2014. Development of RNAi in a Drosophila endoparasitoid wasp and demonstration of its efficiency in impairing venom protein production.J Insect Physiol, 63: 56-61.
[6]	Dong Y, Friedrich M.2005. Nymphal RNAi: Systemic RNAi mediated gene knockdown in juvenile grasshopper.BMC Biotechnol, 5: 25.
[7]	Fabrick J A, Kanost M R, Baker J E.2004. RNAi-induced silencing of embryonic tryptophan oxygenase in the pyralid moth, Plodia interpunctella.J Insect Sci, (4): 15.
[8]	Grubbs N, Haas S, Beeman R W, Lorenzen M D.2015. The ABCs of eye color in Tribolium castaneum: Orthologs of the Drosophila white, scarlet and brown genes.Genetics, 199(3): 749-759.
[9]	Han Q, Calvo E, Marinotti O, Fang J, Rizzi M, James A A, Li J.2003. Analysis of the wild-type and mutant genes encoding the enzyme kynurenine monooxygenase of the yellow fever mosquito, Aedes aegypti.Insect Mol Biol, 12: 483-490.
[10]	Han Q, Robinson H, Li J.2012. Biochemical identification and crystal structure of kynurenine formamidase from Drosophila melanogaster.Biochem J, 446: 253-260.
[11]	Ichiki R, Nakahara Y, Kainoh Y, Nakamura S.2007. Temperature- sensitive eye colour mutation in the parasitoid fly Exorista japonica Townsend (Dipt: Tachinidae).J Appl Entomol, 131: 289-292.
[12]	Khanh H D T, Bressac C, Chevrier C.2005. Male sperm donation consequences in single and double matings in Anisopteromalus calandrae.Physiol Entomol, 30: 29-35.
[13]	Kobayashi I, Uchino K, Sezutsu H, Iizuka T, Tamura T.2007. Development of a new piggyBac vector for generating transgenic silkworms using the kynurenine 3-mono oxygenase gene.J Insect Biotechnol Sericol, 76: 145-148.
[14]	Kômoto N, Quan G X, Sezutsu H, Tamura T.2009. A single-base deletion in an ABC transporter gene causes white eyes, white eggs, and translucent larval skin in the silkworm w-3oe mutant.Insect Biochem Mol Biol, 39: 152-156.
[15]	Le Roes-Hill M, Goodwin C, Burton S.2009. Phenoxazinone synthase: What’s in a name?Trends Biotechnol, 27(4): 248-258.
[16]	Liu S H, Zhang C W, Yang B J, Gu J H, Liu Z W.2010. Cloning and characterization of a putative farnesoic acid omethyltransferase gene from the brown planthopper, Nilaparvata lugens. J Insect Sci, 10: 1-11.
[17]	Liu S H, Yao J, Yao H W, Jiang P L, Yang B J, Tang J.2014. Biological and biochemical characterization of a red-eye mutant in Nilaparvata lugens (Hemiptera: Delphacidae).Insect Sci, 21(4): 469-476.
[18]	Liu S H, Yang B J, Luo J, Tang J, Wu J C.2015. A comparative study on the population fitness of three strains of Nilaparvata lugens (Hemiptera: Delphacidae) differ in eye color-related genes.J Econ Entomol, 108(4): 1675-1682.
[19]	Lloyd V, Ramaswami M, Krämer H.1998. Not just pretty eyes: Drosophila eye-color mutations and lysosomal delivery.Trends Cell Biol, 8: 257-259.
[20]	Lorenzen M D, Brown S J, Denell R E, Beeman R W.2002. Cloning and characterization of the Tribolium castaneum eye-color genes encoding tryptophan oxygenase and kynurenine 3-monooxygenase.Genetics, 160: 225-234.
[21]	Ooi C E, Moreira J E, Dell’Angelica E C, Poy G, Wassarman D A, Bonifacino J S.1997. Altered expression of a novel adaptin leads to defective pigment granule biogenesis in the Drosophila eye color mutant garnet.EMBO J, 16: 4508-4518.
[22]	Phillips J P, Forrest H S, Kulkarni A D.1973. Terminal synthesis of xanthommatin in Drosophila melanogaster: III. Mutational pleiotropy and pigment granule association of phenoxazinone synthetase.Genetics, 73(1): 45-56.
[23]	Quan G X, Kim I, Kômoto N, Sezutsu H, Ote M, Shimada T, Kanda T, Mita K, Kobayashi M, Tamura T.2002. Characterization of the kynurenine 3-monooxygenase gene corresponding to the white egg 1 mutant in the silkworm Bombyx mori.Mol Genet Genom, 267(1): 1-9.
[24]	Rasgon J L, Scott T W.2004. Crimson: A novel sex-linked eye color mutant of Culex pipiens L. (Diptera: Culicidae).J Med Entomol, 41(3): 385-391.
[25]	Seo B Y, Jung J K, Kim Y.2011. An orange-eye mutant of the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae).J Asia-Pac Entomol, 14(4): 469-472.
[26]	Sethuraman N, O’Brochta D A.2005. The Drosophila melanogaster cinnabar gene is a cell autonomous genetic marker in Aedes aegypti (Diptera: Culicidae).J Med Entomol, 42(4): 716-718.
[27]	Shimizu T, Kawasaki K.2001. Red-eye mutants in Orius bugs (Heteroptera: Anthocoridae).Appl Entomol Zool, 36(2): 185-187.
[28]	Vijay N, Morris M E.2014. Role of monocarboxylate transporters in drug delivery to the brain. Curr Pharm Des, 20: 1487-1498.
[29]	Volkova N E, Sheremet O Y, Vorobjova L I.2006. Mating behavior in mutant strains of Drosophila melanogaster at different population densities.Russ J Genet, 42: 392-396.
[30]	Zeng J Y, Han X F, Tan Z L.2008. Monocarboxylate transporter family and their biological function. Chem Life, 28: 404-407.

RichHTML

PDF

可视化

摘要/Abstract

引用本文

使用本文

图/表 6

参考文献 30

相关文章 15

编辑推荐

Metrics

[1]	LI Qianlong, FENG Qi, WANG Heqin, KANG Yunhai, ZHANG Conghe, DU Ming, ZHANG Yunhu, WANG Hui, CHEN Jinjie, HAN Bin, FANG Yu, WANG Ahong. Genome-Wide Dissection of Quan 9311A Breeding Process and Application Advantages[J]. Rice Science, 2023, 30(6): 7-.
[2]	JI Dongling, XIAO Wenhui, SUN Zhiwei, LIU Lijun, GU Junfei, ZHANG Hao, Tom Matthew HARRISON, LIU Ke, WANG Zhiqin, WANG Weilu, YANG Jianchang. Translocation and Distribution of Carbon-Nitrogen in Relation to Rice Yield and Grain Quality as Affected by High Temperature at Early Panicle Initiation Stage[J]. Rice Science, 2023, 30(6): 12-.
[3]	Prathap V, Suresh KUMAR, Nand Lal MEENA, Chirag MAHESHWARI, Monika DALAL, Aruna TYAGI. Phosphorus Starvation Tolerance in Rice Through a Combined Physiological, Biochemical and Proteome Analysis[J]. Rice Science, 2023, 30(6): 8-.
[4]	Serena REGGI, Elisabetta ONELLI, Alessandra MOSCATELLI, Nadia STROPPA, Matteo Dell’ANNO, Kiril PERFANOV, Luciana ROSSI. Seed-Specific Expression of Apolipoprotein A-I_Milano Dimer in Rice Engineered Lines[J]. Rice Science, 2023, 30(6): 6-.
[5]	Sundus ZAFAR, XU Jianlong. Recent Advances to Enhance Nutritional Quality of Rice[J]. Rice Science, 2023, 30(6): 4-.
[6]	Kankunlanach KHAMPUANG, Nanthana CHAIWONG, Atilla YAZICI, Baris DEMIRER, Ismail CAKMAK, Chanakan PROM-U-THAI. Effect of Sulfur Fertilization on Productivity and Grain Zinc Yield of Rice Grown under Low and Adequate Soil Zinc Applications[J]. Rice Science, 2023, 30(6): 9-.
[7]	FAN Fengfeng, CAI Meng, LUO Xiong, LIU Manman, YUAN Huanran, CHENG Mingxing, Ayaz AHMAD, LI Nengwu, LI Shaoqing. Novel QTLs from Wild Rice Oryza longistaminata Confer Rice Strong Tolerance to High Temperature at Seedling Stage[J]. Rice Science, 2023, 30(6): 14-.
[8]	LIN Shaodan, YAO Yue, LI Jiayi, LI Xiaobin, MA Jie, WENG Haiyong, CHENG Zuxin, YE Dapeng. Application of UAV-Based Imaging and Deep Learning in Assessment of Rice Blast Resistance[J]. Rice Science, 2023, 30(6): 10-.
[9]	Md. Forshed DEWAN, Md. AHIDUZZAMAN, Md. Nahidul ISLAM, Habibul Bari SHOZIB. Potential Benefits of Bioactive Compounds of Traditional Rice Grown in South and South-East Asia: A Review[J]. Rice Science, 2023, 30(6): 5-.
[10]	Raja CHAKRABORTY, Pratap KALITA, Saikat SEN. Phenolic Profile, Antioxidant, Antihyperlipidemic and Cardiac Risk Preventive Effect of Chakhao Poireiton (A Pigmented Black Rice) in High-Fat High-Sugar induced Rats[J]. Rice Science, 2023, 30(6): 11-.
[11]	. [J]. Rice Science, 2021, 28(3): 217-232.
[12]	. [J]. Rice Science, 2019, 26(2): 118-124.
[13]	. [J]. Rice Science, 2019, 26(2): 77-87.
[14]	. [J]. Rice Science, 2019, 26(2): 88-97.
[15]	. [J]. Rice Science, 2019, 26(2): 98-108.