
Rice Science ›› 2020, Vol. 27 ›› Issue (1): 32-43.DOI: 10.1016/j.rsci.2019.12.004
• Research Paper • Previous Articles Next Articles
Barik Jijnasa1, Kumar Vajinder2, K. Lenka Sangram3, Panda Debabrata1(
)
Received:2018-08-20
Accepted:2018-12-04
Online:2020-01-28
Published:2019-09-30
Barik Jijnasa, Kumar Vajinder, K. Lenka Sangram, Panda Debabrata. Assessment of Variation in Morpho-Physiological Traits and Genetic Diversity in Relation to Submergence Tolerance of Five Indigenous Lowland Rice Landraces[J]. Rice Science, 2020, 27(1): 32-43.
Add to citation manager EndNote|Ris|BibTeX
| Parameter | Source of variation | ||
|---|---|---|---|
| Variety (df = 89) | Treatment (df = 1) | Variety × treatment (df = 89) | |
| SPAD index | 3 156** (21.4%) | 8 936** (60.7%) | 2 229** (15.1%) |
| Chlorophyll | 36.08** (22.2%) | 108.40** (66.8%) | 16.25** (10.0%) |
| Dry mass | 1223** (19.4%) | 4 246** (67.5%) | 585* (9.3%) |
| Soluble sugar | 10 405** (21.8%) | 28 407** (59.5%) | 8 357** (17.5%) |
| Starch | 36 634** (43.8%) | 38 310** (45.8%) | 7 819* (9.3%) |
Table 1 Analysis of variance of studied parameters in rice seedlings subjected to submergence.
| Parameter | Source of variation | ||
|---|---|---|---|
| Variety (df = 89) | Treatment (df = 1) | Variety × treatment (df = 89) | |
| SPAD index | 3 156** (21.4%) | 8 936** (60.7%) | 2 229** (15.1%) |
| Chlorophyll | 36.08** (22.2%) | 108.40** (66.8%) | 16.25** (10.0%) |
| Dry mass | 1223** (19.4%) | 4 246** (67.5%) | 585* (9.3%) |
| Soluble sugar | 10 405** (21.8%) | 28 407** (59.5%) | 8 357** (17.5%) |
| Starch | 36 634** (43.8%) | 38 310** (45.8%) | 7 819* (9.3%) |
Fig. 1. Relationship of different morpho-physiological traits with survival rate of studied landraces after 14 d of submergence.===DM, Dry mass; RGI, Relative growth index.
| Trait | Range | Mean ± SE | σ2G | σ2P | GCV (%) | PCV (%) | h2 (%) | GA | GAM |
|---|---|---|---|---|---|---|---|---|---|
| Relative growth index (%) | 33.9-95.9 | 60.5 ± 1.2 | 200.100 | 201.700 | 23.304 | 23.397 | 99.21 | 29.024 | 47.8 |
| Survival rate (%) | 5.0-98.0 | 33.8 ± 6.7 | 433.050 | 479.150 | 62.870 | 66.131 | 90.38 | 40.754 | 123.1 |
| Shoot elongation (%) | 10.5-97.4 | 67.2 ± 1.6 | 560.400 | 563.000 | 36.476 | 36.560 | 99.54 | 48.653 | 75.0 |
| SPAD | 3.4-31.1 | 23.9 ± 0.7 | 16.910 | 17.335 | 17.206 | 17.421 | 97.55 | 8.367 | 35.0 |
| Chlorophll (mg/g) | 0.14-2.00 | 1.18 ± 0.10 | 0.192 | 0.195 | 37.134 | 37.423 | 98.46 | 0.896 | 75.9 |
| Dry mass (%) | 5.3-18.6 | 13.9 ± 0.7 | 6.235 | 6.715 | 17.964 | 18.643 | 92.85 | 4.957 | 35.7 |
| Soluble sugar (mg/g) | 8.2-46.2 | 31.4 ± 0.8 | 56.400 | 57.150 | 23.917 | 24.076 | 98.69 | 15.369 | 48.9 |
| Starch (mg/g) | 20.3-74.2 | 44.73 ± 0.98 | 200.290 | 201.250 | 31.640 | 31.715 | 99.52 | 29.084 | 65.0 |
Table 2 Genetic variability parameters for different traits of indigenous rice landraces from Koraput, India.
| Trait | Range | Mean ± SE | σ2G | σ2P | GCV (%) | PCV (%) | h2 (%) | GA | GAM |
|---|---|---|---|---|---|---|---|---|---|
| Relative growth index (%) | 33.9-95.9 | 60.5 ± 1.2 | 200.100 | 201.700 | 23.304 | 23.397 | 99.21 | 29.024 | 47.8 |
| Survival rate (%) | 5.0-98.0 | 33.8 ± 6.7 | 433.050 | 479.150 | 62.870 | 66.131 | 90.38 | 40.754 | 123.1 |
| Shoot elongation (%) | 10.5-97.4 | 67.2 ± 1.6 | 560.400 | 563.000 | 36.476 | 36.560 | 99.54 | 48.653 | 75.0 |
| SPAD | 3.4-31.1 | 23.9 ± 0.7 | 16.910 | 17.335 | 17.206 | 17.421 | 97.55 | 8.367 | 35.0 |
| Chlorophll (mg/g) | 0.14-2.00 | 1.18 ± 0.10 | 0.192 | 0.195 | 37.134 | 37.423 | 98.46 | 0.896 | 75.9 |
| Dry mass (%) | 5.3-18.6 | 13.9 ± 0.7 | 6.235 | 6.715 | 17.964 | 18.643 | 92.85 | 4.957 | 35.7 |
| Soluble sugar (mg/g) | 8.2-46.2 | 31.4 ± 0.8 | 56.400 | 57.150 | 23.917 | 24.076 | 98.69 | 15.369 | 48.9 |
| Starch (mg/g) | 20.3-74.2 | 44.73 ± 0.98 | 200.290 | 201.250 | 31.640 | 31.715 | 99.52 | 29.084 | 65.0 |
Fig. 2. Principal component analysis (PCA) of different rice landraces showing genotypic relationship in a graphical representation scatter plot on the basis of different morpho-physiological traits under submergence.===RGI, Relative growth index; S, Survival rate; E, Shoot elongation.
| Parameter | PC1 | PC2 | PC3 | PC4 | PC5 | PC6 | PC7 | PC8 |
|---|---|---|---|---|---|---|---|---|
| Relative growth index | 0.336 | 0.070 | 0.879 | -0.277 | 0.091 | -0.042 | -0.151 | -0.011 |
| Survival rate (%) | 0.726 | 0.390 | -0.431 | -0.348 | 0.080 | -0.085 | 0.003 | -0.003 |
| Shoot elongation (%) | -0.421 | 0.901 | 0.097 | 0.012 | -0.033 | -0.033 | 0.010 | -0.003 |
| SPAD | 0.085 | 0.067 | -0.001 | 0.454 | 0.879 | 0.012 | -0.094 | 0.002 |
| Chlorophyll | 0.010 | 0.005 | 0.010 | 0.010 | -0.010 | -0.026 | -0.009 | 0.999 |
| Dry mass | 0.068 | 0.009 | 0.138 | 0.016 | 0.089 | -0.013 | 0.984 | 0.007 |
| Soluble sugar | 0.231 | 0.124 | 0.056 | 0.288 | -0.192 | 0.899 | 0.000 | 0.015 |
| Starch | 0.342 | 0.109 | 0.104 | 0.716 | -0.407 | -0.425 | -0.020 | -0.027 |
| Eigen value | 5.596 | 0.796 | 0.605 | 0.445 | 0.331 | 0.105 | 0.080 | 0.040 |
| Variance (%) | 72.965 | 18.040 | 5.815 | 1.582 | 0.928 | 0.632 | 0.034 | 0.004 |
Table 3 Correlations between initial variables with principal component and component loading.
| Parameter | PC1 | PC2 | PC3 | PC4 | PC5 | PC6 | PC7 | PC8 |
|---|---|---|---|---|---|---|---|---|
| Relative growth index | 0.336 | 0.070 | 0.879 | -0.277 | 0.091 | -0.042 | -0.151 | -0.011 |
| Survival rate (%) | 0.726 | 0.390 | -0.431 | -0.348 | 0.080 | -0.085 | 0.003 | -0.003 |
| Shoot elongation (%) | -0.421 | 0.901 | 0.097 | 0.012 | -0.033 | -0.033 | 0.010 | -0.003 |
| SPAD | 0.085 | 0.067 | -0.001 | 0.454 | 0.879 | 0.012 | -0.094 | 0.002 |
| Chlorophyll | 0.010 | 0.005 | 0.010 | 0.010 | -0.010 | -0.026 | -0.009 | 0.999 |
| Dry mass | 0.068 | 0.009 | 0.138 | 0.016 | 0.089 | -0.013 | 0.984 | 0.007 |
| Soluble sugar | 0.231 | 0.124 | 0.056 | 0.288 | -0.192 | 0.899 | 0.000 | 0.015 |
| Starch | 0.342 | 0.109 | 0.104 | 0.716 | -0.407 | -0.425 | -0.020 | -0.027 |
| Eigen value | 5.596 | 0.796 | 0.605 | 0.445 | 0.331 | 0.105 | 0.080 | 0.040 |
| Variance (%) | 72.965 | 18.040 | 5.815 | 1.582 | 0.928 | 0.632 | 0.034 | 0.004 |
Fig. 3. Similarity index showing in dendrogram of different indigenous rice landraces constructed based on morpho-physiological traits under submergence.
| Primer | Chr. | Forward | Reverse | Size (bp) | Na | Ne | Ho | He | Nei’s | PIC |
|---|---|---|---|---|---|---|---|---|---|---|
| Sub1-A203 | 9 | CTTCTTGCTCAACGACAACG | AGGCTCCAGATGTCCATGTC | 200-220 | 2 | 1.3 | 0.736 | 0.264 | 0.245 | 0.833 |
| Sub1-BC2 | 9 | AAAACAATGGTTCCATACGAGAC | GCCTATCAATGCGTG CTCTT | 230-260 | 2 | 1.9 | 0.506 | 0.495 | 0.459 | 0.796 |
| Sub1-C173 | 9 | AACGCCAAGACCAACTTCC | AGGAGGCTG TCCATCAGG | 130-180 | 2 | 1.3 | 0.736 | 0.264 | 0.245 | 0.388 |
| RM3475 | 1 | GTCGGTTTGCCTAGTTGAGC | TTCCTCGGTGTATGGGTCTC | 150-160 | 2 | 2.0 | 0.473 | 0.528 | 0.490 | 0.857 |
| RM478 | 7 | CAGCTGGGGAAGAGAGAGAG | TCAGAAACTAAACGCACCCC | 200-220 | 2 | 2.0 | 0.473 | 0.528 | 0.490 | 0.735 |
| Mean | 2 | 1.7 | 0.585 | 0.415 | 0.386 | 0.386 | ||||
| SD | 0 | 0.3 | 0.139 | 0.139 | 0.129 | 0.129 |
Table 4 Details of molecular marker used for genotyping study and genetic diversity parameters.
| Primer | Chr. | Forward | Reverse | Size (bp) | Na | Ne | Ho | He | Nei’s | PIC |
|---|---|---|---|---|---|---|---|---|---|---|
| Sub1-A203 | 9 | CTTCTTGCTCAACGACAACG | AGGCTCCAGATGTCCATGTC | 200-220 | 2 | 1.3 | 0.736 | 0.264 | 0.245 | 0.833 |
| Sub1-BC2 | 9 | AAAACAATGGTTCCATACGAGAC | GCCTATCAATGCGTG CTCTT | 230-260 | 2 | 1.9 | 0.506 | 0.495 | 0.459 | 0.796 |
| Sub1-C173 | 9 | AACGCCAAGACCAACTTCC | AGGAGGCTG TCCATCAGG | 130-180 | 2 | 1.3 | 0.736 | 0.264 | 0.245 | 0.388 |
| RM3475 | 1 | GTCGGTTTGCCTAGTTGAGC | TTCCTCGGTGTATGGGTCTC | 150-160 | 2 | 2.0 | 0.473 | 0.528 | 0.490 | 0.857 |
| RM478 | 7 | CAGCTGGGGAAGAGAGAGAG | TCAGAAACTAAACGCACCCC | 200-220 | 2 | 2.0 | 0.473 | 0.528 | 0.490 | 0.735 |
| Mean | 2 | 1.7 | 0.585 | 0.415 | 0.386 | 0.386 | ||||
| SD | 0 | 0.3 | 0.139 | 0.139 | 0.129 | 0.129 |
| Genotype | Samudrabali | Surudaka | Godoba | Basnamundi | Dokrakuji | IR42 |
|---|---|---|---|---|---|---|
| Surudaka | 0.500 | |||||
| Godoba | 0.500 | 0.111 | ||||
| Basnamundi | 0.556 | 0.333 | 0.714 | |||
| Dokrakuji | 0.625 | 0.833 | 0.222 | 0.444 | ||
| IR42 | 0.222 | 0.500 | 0.125 | 0.375 | 0.429 | |
| FR13A | 0.625 | 0.375 | 0.571 | 0.625 | 0.500 | 0.111 |
Table 5 Genetic distance between the studied rice genotypes on the basis of SSR markers.
| Genotype | Samudrabali | Surudaka | Godoba | Basnamundi | Dokrakuji | IR42 |
|---|---|---|---|---|---|---|
| Surudaka | 0.500 | |||||
| Godoba | 0.500 | 0.111 | ||||
| Basnamundi | 0.556 | 0.333 | 0.714 | |||
| Dokrakuji | 0.625 | 0.833 | 0.222 | 0.444 | ||
| IR42 | 0.222 | 0.500 | 0.125 | 0.375 | 0.429 | |
| FR13A | 0.625 | 0.375 | 0.571 | 0.625 | 0.500 | 0.111 |
| [1] | Afrin W, Nafis M H, Hossain M A, Islam M M, Hossain M A,.2018. Responses of rice (Oryza sativa L.) genotypes to different levels of submergence. Compt Rend Biol, 341(2): 85-96. |
| [2] | Angaji S A, Septiningsih E M, Mackill D J, Ismail A M.2010. QTLs associated with tolerance of flooding during germination in rice (Oryza sativa L.). Euphytica, 172(2): 159-168. |
| [3] | Arnon D I.1949. Copper enzymes in isolated chloroplasts, polyphenol oxidase inBeta vulgaris. Plant Physiol, 24(1): 1-15. |
| [4] | Arunachalam V, Chaudhury S S, Sarangi S K, Ray T, Mohanty B P, Mishra S.2006. Rising on Rice: The Story of Jeypore. [MS Thesis]. Chennai, India: Swaminathan Research Foundation. |
| [5] | Bailey-Serres J, Voesenek L A C J.2008. Flooding stress: Acclimations and genetic diversity.Annu Rev Plant Biol, 59: 313-339. |
| [6] | Bailey-Serres J, Fukao T, Ronald P, Ismail A, Heuer S, Mackill D.2010. Submergence tolerant rice:SUB1’s journey from landrace to modern cultivar. Rice, 3: 138-147. |
| [7] | Bhattacharjee S.2008. Calcium-dependent signaling pathway in heatinduced oxidative injury inAmaranthus lividus. Biol Plant, 52(1): 137-140. |
| [8] | Burton G W, Devane E H.1953. Estimating heritability in tall fescue (Festuca Arundinacea) from replicated clonal material 1. Agron J, 45(10): 478-481. |
| [9] | Colmer T D, Pedersen O.2008. Oxygen dynamics in submerged rice (Oryza sativa). New Phytol, 178(2): 326-334. |
| [10] | Dar M H, Chakravorty R, Waza S A, Sharma M, Zaidi N W, Singh A N, Singh U S, Ismail A M.2017. Transforming rice cultivation in flood prone coastal Odisha to ensure food and economic security.Food Sec, 9(4): 711-722. |
| [11] | Das K K, Sarkar R K, Ismail A M.2005. Elongation ability and non-structural carbohydrate levels in relation to submergence tolerance in rice.Plant Sci, 168(1): 131-136. |
| [12] | Das K K, Panda D, Sarkar R K, Reddy J N, Ismail A M.2009. Submergence tolerance in relation to variable floodwater conditions in rice.Environ Exp Bot, 66(3): 425-434. |
| [13] | Dey N, Biswas S, Chaudhuri T, Dey S, De M, Ghose T.2005. RAPD-based genetic diversity analysis of aromatic rice (Oryza sativa L.). Plant Cell Biotech Mol Biol, 6(3/4): 133-142. |
| [14] | Fukao T, Yeung E, Bailey-Serres J.2011. The submergence tolerance regulatorSUB1A mediates crosstalk between submergence and drought tolerance in rice. Plant Cell, 23: 412-427. |
| [15] | Goswami S, Kar R K, Paul A, Dey N.2017. Genetic potentiality of indigenous rice genotypes from Eastern India with reference to submergence tolerance and deepwater traits.Curr Plant Biol, 11(12): 23-32. |
| [16] | Guei R G, Sanni K A, Abamu F J, Fawole I.2005. Genetic diversity of rice (Oryza sativa L.). Agron Afr, 5: 17-28. |
| [17] | Hashimoto Z, Mori N, Kawamura M, Ishii T, Yoshida S, Ikegami M, Takumi S, Nakamura C.2004. Genetic diversity and phylogeny of Japanese sake-brewing rice as revealed by AFLP and nuclear and chloroplast SSR markers.Theor Appl Genet, 109(8): 1586-1596. |
| [18] | Hwang T Y, Sayama T, Takahashi M, Takada Y, Nakamoto Y, Funatsuki H, Hisano H, Sasamoto S, Sato S, Tabata S, Kono I, Hoshi M, Hanawa M, Yano C, Xia Z J, Harada K, Kitamura K, Ishimoto M.2009. High-density integrated linkage map based on SSR markers in soybean.DNA Res, 16(4): 213-225. |
| [19] | Iftekharuddaula K M, Ahmed H U, Ghosal S, Amin A, Moni Z R, Ray B P, Barman H N, Siddique M A, Collard B C Y, Septiningsih E M.2016. Development of early maturing submergence-tolerant rice varieties for Bangladesh.Field Crops Res, 190: 44-53. |
| [20] | Ismail A M, Singh U S, Singh S, Dar M H, Mackill D J.2013. The contribution of submergence-tolerant (Sub1) rice varieties to food security in flood-prone rainfed lowland areas in Asia.Field Crops Res, 152: 83-93. |
| [21] | Jackson M B, Waters I, Setter T, Greenway H.1987. Injury to rice plants caused by complete submergence: A contribution by ethylene.J Exp Bot, 38: 1826-1838. |
| [22] | Jackson M B, Ram P C.2003. Physiological and molecular basis of susceptibility and tolerance of rice plants to complete submergence.Ann Bot, 91: 227-241. |
| [23] | Johnson H W, Robinson H F, Comstock R E.1955. Estimates of genetic and environmental variability in soybeans.Agron J, 47(7): 314-318. |
| [24] | Kimura M, Crow J F.1964. The number of alleles that can be maintained in a finite population.Genetics, 49(4): 725-738. |
| [25] | Kuanar S R, Ray A, Sethi S K, Chattopadhyay K, Sarkar R K.2017. Physiological basis of stagnant flooding tolerance in rice.Rice Sci, 24(2): 73-84. |
| [26] | Mazaredo A M, Vergara B S.1982. Physiological differences in rice varieties tolerant and susceptible to complete submergence. In: Proceedings of the 1981 International Deepwater Rice Workshop. Manila, the Phillippines: International Rice Research Institute: 327-341. |
| [27] | Mohanty H K, Mallik S, Grover A.2000. Prospects of improving flooding tolerance in lowland rice varieties by conventional breeding and genetic engineering.Curr Sci, 78(2): 132-137. |
| [28] | Mohapatra M R, Acharya P, Sengupta S.2007. Variability and association analysis in Okra.Ind Agric, 51(1/2): 17-26. |
| [29] | Murray M G, Thompson W F.1980. Rapid isolation of high molecular weight plant DNA.Nucl Acids Res, 8(19): 4321-4325. |
| [30] | Neeraja C N, Maghirang-Rodriguez R, Pamplona A, Heuer S, Collard B C, Septiningsih E M, Vergara G, Sanchez D, Xu K, Ismail A M, Mackill D J.2007. A marker-assisted backcross approach for developing submergence-tolerance rice cultivars.Theor Appl Genet, 115(6): 767-776. |
| [31] | Nei M.1973. Analysis of gene diversity in subdivided populations.Proc Natl Acad Sci USA, 70(12): 3321-3323. |
| [32] | Panaud O, Chen X, McCouch S R.1996. Development of microsatellite markers and characterization of simple sequence length polymorphism (SSLP) in rice (Oryza sativa L.). Mol Gen Genet, 252(5): 597-607. |
| [33] | Panda D, Rao D N, Sharma S G, Strasser R J, Sarkar R K.2006. Submergence effects on rice genotypes during seedling stage: Probing of submergence driven changes of photosystem II by chlorophyll a fluorescence induction O-J-I-P transients.Photosynthetica, 44: 69-75. |
| [34] | Panda D, Sharma S G, Sarkar R K.2008. Chlorophyll fluorescence parameters, CO2 photosynthetic rate and regeneration capacity as a result of complete submergence and subsequent re-emergence in rice (Oryza sativa L.). Aquat Bot, 88(2): 127-133. |
| [35] | Panda D, Sarkar R K.2012. Leaf photosynthetic activity and antioxidant defense associated withSub1 QTL in rice subjected to submergence and subsequent re-aeration. Rice Sci, 19(2): 108-116. |
| [36] | Patra B C, Dhua S R.2003. Agro-morphoogical diversity scenario in upland rice germplasm of Jeypore tract.Genet Resour Crop Evol, 50(8): 825-828. |
| [37] | Pradhan S K, Barik S R, Sahoo J, Pandit E, Nayak D K, Pani D R, Anandan A.2015. Comparison ofSub1 markers and their combinations for submergence tolerance and analysis of adaptation strategies of rice in rainfed lowland ecology. Compt Rend Biol, 338(10): 650-659. |
| [38] | Rahman B A N M R, Zhang J.2016. Flood and drought tolerance in rice: Opposite but may coexist.Food Energ Sec, 5(2): 76-88. |
| [39] | Ram P C, Singh B B, Singh A K, Ram P, Singh P N, Singh H P, Boamfa I, Harren F, Santosa E, Jackson M B, Setter T L, Reuss J, Wade L J, Singh V P, Singh R K.2002. Submergence tolerance in rainfed lowland rice physiological basis and prospects for cultivar improvement through marker-aided breeding.Field Crops Res, 76: 131-152. |
| [40] | Roy P S, Patnaik A, Rao G J N, Patnaik S S C, Chaudhury S S, Sharma S G.2016. Participatory and molecular marker assisted pure line selection for refinement of three premium rice landraces of Koraput, India.Agroecol Sust Food, 41(2): 167-185. |
| [41] | Samal R, Roy P S, Sahoo A, Kar M K, Patra B C, Marndi B C, Gundimeda J N R.2018. Morphological and molecular dissection of wild rice from eastern India suggests distinct speciation betweenO. rufipogon and O. nivara populations. Sci Rep, 8: 2773. |
| [42] | Sarkar R K, Reddy J N, Sharma S G, Ismail A M.2006. Physiological basis of submergence tolerance in rice and implications for crop improvement.Curr Sci, 91: 899-906. |
| [43] | Sarkar R K, Panda D, Reddy J N, Patnaik S S C, Mackill D J, Ismail A M.2009. Performance of submergence tolerant rice (Oryza sativa) genotypes carrying the Sub1 quantitative trait locus under stressed and non-stressed natural field conditions. Ind J Agric Sci, 79(11): 876-883. |
| [44] | Sarkar R K, Bhattacharjee B.2011. Rice genotype withSUB1 QTL differ in submergence tolerance, elongation ability during submergence and re-generation growth at re-emergence. Rice, 5: 7. |
| [45] | Septiningsih E M, Pamplona A M, Sanchez D L, Neeraja C N, Vergara G V, Heuer S, Ismail A M, Mackill D J.2009. Development of submergence-tolerant rice cultivars: TheSub1 locus and beyond. Ann Bot, 103(2): 151-160. |
| [46] | Septiningsih E M, Sanchez D L, Singh N, Sendon P M D, Pamplona A M, Heuer S, Mackill D J.2012. Identifying novel QTLs for submergence tolerance in rice cultivars IR72 and Madabaru.Theor Appl Genet, 124(5): 867-874. |
| [47] | Septiningsih E M, Collard B C Y, Heuer S, Bailey-Serres J, Ismail A M, Mackill D J.2013. Applying genomics tools for breeding submergence tolerance in rice. In: Varshney R K, Tuberosa R. Translational Genomics for Crop Breeding. New York, USA: Wiley-Blackwell: 9-30. |
| [48] | Shrestha S, Brueck H, Asch F.2012. Chlorophyll index, photochemical reflectance index and chlorophyll fluorescence measurements of rice leaves supplied with different N levels.J Photochem Photobiol B: Biol, 113: 7-13. |
| [49] | Singh A, Septiningsih E M, Balyan H S, Singh N K, Rai V.2017. Genetics, physiological mechanisms and breeding of flood-tolerant rice (Oryza sativa L.). Plant Cell Physiol, 58(2): 185-197. |
| [50] | Singh R, Singh Y, Xalaxo S, Verulkar S, Yadav N, Singh S, Singh N, Prasad K S N, Kondayya K, Rao P V R, Rani M G, Anuradha T, Suraynarayana Y, Sharma P C, Krishnamurthy S L, Sharma S K, Dwivedi J L, Singh A K, Singh P K, Nilanjay, Singh N K, Kumar R, Chetia S K, Ahmad T, Rai M, Perraju P, Pande A, Singh D N, Mandal N P, Reddy J N, Singh O N, Katara J L, Maradi B, Swain P, Sarkar R K, Singh D P, Mohapatra T, Padmawathi G, Ram T, Kathiresan R M, Paramsivam K, Nadarajan S, Thirumeni S, Nagarajan M, Singh A K, Vikram P, Kumwe A, Septiningshih E, Singh U S, Ismail A M, Mackill D, Singh N K,.2016. From QTL to variety-harnessing the benefits of QTLs for drought, flood and salt tolerance in mega rice varieties of India through a multi-institutional network.Plant Sci, 242: 278-287. |
| [51] | Singh S, Mackill D J, Ismail A M.2014. Physiological basis of tolerance to complete submergence in rice involves genetic factors in addition to the SUB1 gene. AoB Plants, 6: plu060. |
| [52] | Sinha A K, Mishra P K.2013. Morphology based multivariate analysis of phenotypic diversity of landraces of rice (Oryza sativa L.) of Bankura district of West Bengal. J Crop Weed, 9(2): 115-121. |
| [53] | Steel R G, Torrie J H, Dickey D A.1997. Principles and Procedures of Statistics: A biological Approach. McGraw-Hill. |
| [54] | Toojinda T, Siangliw M, Tragoonrung S, Vanavichit A.2003. Molecular genetics of submergence tolerance in rice: QTL analysis of key traits.Ann Bot, 91(2): 243-253. |
| [55] | Xu K, Xu X, Fukao T, Canalas P, Maghirang-Rodriguez R, Heuer S, Ismail A M, Bailey-Serres J, Ronald P C, Mackill D J.2006. Sub1A is an ethylene responsive-factor-like gene that confers submergence tolerance to rice. Nature, 442: 705-708. |
| [56] | Yeh F C, Boyle T J B.1997. Population genetic analysis of codominant and dominant markers and quantitative traits.Belgian J Bot, 129: 157-163. |
| [57] | Yoshida S, Forno D A, Cock J H, Gomez K A.1976. Laboratory Manual for Physiological Studies of Rice. Manila, the Phillippines: International Rice Research Institute: 14-46. |
| [1] | Md. Forshed DEWAN, Md. AHIDUZZAMAN, Md. Nahidul ISLAM, Habibul Bari SHOZIB. Potential Benefits of Bioactive Compounds of Traditional Rice Grown in South and South-East Asia: A Review [J]. Rice Science, 2023, 30(6): 5-. |
| [2] | Kossi Lorimpo Adjah, Maxwell Darko Asante, Aboubacar Toure, Mawuli Aziadekey, Francis Osei Amoako-Andoh, Michael Frei, Yacouba Diallo, Komi Agboka. Improvement of Rice Production under Drought Conditions in West Africa: Application of QTLs in Breeding for Drought Resistance [J]. Rice Science, 2022, 29(6): 512-521. |
| [3] | Yanchang Luo, Tingchen Ma, Teo Joanne, Zhixiang Luo, Zefu Li, Jianbo Yang, Zhongchao Yin. Marker-Assisted Breeding of Thermo-Sensitive Genic Male Sterile Line 1892S for Disease Resistance and Submergence Tolerance [J]. Rice Science, 2021, 28(1): 89-98. |
| [4] | Panda Debabrata, Barik Jijnasa. Flooding Tolerance in Rice: Focus on Mechanisms and Approaches [J]. Rice Science, 2021, 28(1): 43-57. |
| [5] | Chandra Roy Subhas, Bhasker Reddy Lachagari Vijaya. Assessment of SNP and InDel Variations Among Rice Lines of Tulaipanji x Ranjit [J]. Rice Science, 2017, 24(6): 336-348. |
| [6] | Md Iftekharuddaula Khandakar, Uddin Ahmed Helal, Ghosal Sharmistha, Rahman Moni Zakiah, Amin Al, Shamsher Ali Md. Development of New Submergence Tolerant Rice Variety for Bangladesh Using Marker-Assisted Backcrossing [J]. Rice Science, 2015, 22(1): 16-26. |
| [7] | Sunayana RATHI, Raj Narain Singh YADAV, Ramendra Nath SARMA. Variability in Grain Quality Characters of Upland Rice of Assam, India [J]. RICE SCIENCE, 2010, 17(4): 330-333 . |
| [8] | ZHANG Ya-li, XU Ming-hui, ZENG Ya-wen, YAO Chun-xin, CHEN Shan-na. Relationship Between the First Base of the Donor Splice Site of Waxy Gene Intron 1 and Amylose Content in Yunnan Indigenous Rice Varieties [J]. RICE SCIENCE, 2007, 14(3): 189-194 . |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||