Production of Two Elite Glutinous Rice Varieties by Editing Wx Gene

doi:10.1016/j.rsci.2018.04.007

Abstract

Abstract:

The waxy gene (Wx) in rice, which encodes the granule bound starch synthase enzyme, is responsible for amylose synthesis. Glutinous (sticky) rice has little or no amylose that can be used in various applications, such as brewing. In this study, knockout of the Wx gene with CRISPR/Cas9 technology was conducted in two elite japonica rice lines, Huaidao 5 (HD5) and Suken 118 (SK118), aiming to develop elite sticky rice varieties. We achieved six homozygous T₀ plants with more than 200 bp deletion in the Wx gene, as well as 36 wx-HD5 and 18 wx-SK118 homozygous transgene-free plants in the T₁ generation. The seeds of all the mutants were white and opaque, similar to those of sticky rice, and contained only 2.6%-3.2% amylose. Results of scanning electron microscopy showed that the quality of rice did not change. In conclusion, we successfully developed two elite sticky rice varieties.

Key words: amylose, CRISPR, Cas9, rice, starch, Wx

Yunyan Fei, Jie Yang, Fangquan Wang, Fangjun Fan, Wenqi Li, Jun Wang, Yang Xu, Jinyan Zhu, Weigong Zhong. Production of Two Elite Glutinous Rice Varieties by Editing Wx Gene[J]. Rice Science, 2019, 26(2): 118-124.

Figures/Tables 6

Table 1 Primers used in this study

Primer	Sequence (5′-3′)	Purpose
T1-F	GGCACACGTCCCAGCTCGCCACCT	Vector construction
T1-R	AAACAGGTGGCGAGCTGGGACGTG	Vector construction
T2-F	GCCGTCCGTCGTCGTGTACGCCAC	Vector construction
T2-R	AAACGTGGCGTACACGACGACGGA	Vector construction
Wx-F	TAGCCACCCAAGAAACT	Amplification of the fragments across sgRNAs
Wx-R	CTACCTCAGCCACAACG	Amplification of the fragments across sgRNAs
hyg283-F	TCCGGAAGTGCTTGACATT	Vector deletion (HPTII)
hyg283-R	GTCGTCCATCACAGTTTGC	Vector deletion (HPTII)
Cas9-F	TTCGACCAGTCCAAGAACGG	Vector deletion (Cas9) (Wang et al, 2016)
Cas9-R	CTTGACCTTGGTGAGCTCGT	Vector deletion (Cas9) (Wang et al, 2016)

Fig. 1 Schematic diagrams of the Wx and CRISPR/Cas9 vector.A, Overview of the Wx gene structure and target sites for sgRNAs (T1 and T2). Exons and introns in Wx gene are depicted by orange rectangles and white rectangles, respectively. The target sequences of sgRNAs are shown at the top of the gene structure in red. B, The structure of the Wx gene editing system. T1 and T2 are driven by U3 and U6a promoters, respectively. RB, Right border; LB, Left border; Cas9, CRISPR associated protein 9 gene; HPTII, Hygromycin-resistance gene.

Fig. 2 CRISPR/Cas9-induced mutations in the Wx gene.A, PCR analysis of HPTII in T0 lines (part of the picture). M, DNA marker; 1, wx-SK118-1; 2, wx-SK118-2; 3, wx-SK118-3; 4, wx-HD5-1; 5, wx-HD5-2; 6, wx-HD5-3; 7, Positive control of pYLCRISPR/Cas9-MH-Wx; 8, Negative control of SK118; 9, Negative control of HD5; 10, Negative control of ddH2O. B, Polymerase chain reaction assays of Wx in T0 lines. M, DNA marker; 1, wx-SK118-1; 2, wx-SK118-2; 3, wx-SK118-3; 4, wx-HD5-1; 5, wx-HD5-2; 6, wx-HD5-3; 7, Control of SK118; 8, Control of HD5. C, Sequencing results of T0 mutant lines. sgRNA is shown in red letter; Insertion sequence is shown in green letter; Deletion sequence is shown by dashed line.

Table 2 Segregation of transgene-free rice in T1 generation.

Line	No. of examined plants	No. of transgene-free plants
wx-SK118-1	10	3
wx-SK118-2	23	5
wx-SK118-3	85	10
wx-HD5-1	53	6
wx-HD5-2	135	17
wx-HD5-3	47	13

Fig. 3 Phenotype of the Wx mutants.A, Intact polished rice. B, Grains stained with iodine solution. C, Amylose content of Wx mutants. Data represent Mean ± SD (n = 3). **, Significant at the 0.01 level by the t-test.

Fig. 4 Cross-sections of endosperm in rice.

References 40

[1]	Baysal C, Bortesi L, Zhu C, Farre G, Schillberg S, Christou P.2016. CRISPR/Cas9 activity in the rice OsBEIIb gene does not induce off-target effects in the closely related paralog OsBEIIa. Mol Breeding, 36: 108.
[2]	Cai J W, Man J M, Huang J, Liu Q Q, Wei W X, Wei C X.2015. Relationship between structure and functional properties of normal rice starches with different amylose contents.Carbohyd Polym, 125: 35-44.
[3]	Chen M H, Bergman C, Pinson S, Fjellstrom R.2008. Waxy gene haplotypes: Associations with apparent amylose content and the effect by the environment in an international rice germplasm collection.J Cereal Sci, 47(3): 536-545.
[4]	Cho S W, Kim S, Kim J M, Kim JS.2013. Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease.Nat Biotechnol, 31: 230-232.
[5]	Fasahat P, Rahman S, Ratnam W.2014. Genetic controls on starch amylose content in wheat and rice grains.J Genet, 93(1): 279-292.
[6]	Ishizaki T.2016. CRISPR/Cas9 in rice can induce new mutations in later generations, leading to chimerism and unpredicted segregation of the targeted mutation.Mol Breeding, 36(12): 165.
[7]	Juliano B O, Perez C M, Blakeney A B, Castillo D T, Kongseree N, Laignelet B, Lapis E T, Murty V V S, Paule C M, Webb B D.1981. International cooperative testing on the amylose content of milled rice.Starch-Stärke, 33(5): 157-162.
[8]	Kasem S, Waters D L E, Rice N F, Shapter F M, Henry R J.2011. The endosperm morphology of rice and its wild relatives as observed by scanning electron microscopy.Rice, 4(1): 12-20.
[9]	Kawagoe Y, Kubo A, Satoh H, Takaiwa F, Nakamura Y.2005. Roles of isoamylase and ADP-glucose pyrophosphorylase in starch granule synthesis in rice endosperm.Plant J, 42: 164-174.
[10]	Kiswara G, Lee J H, Hur Y J, Cho J H, Lee J Y, Kim S Y, Sohn Y B, Song Y C, Nam M H, Yun B W.2014. Genetic analysis and molecular mapping of low amylose genedu12(t) in rice, 127(1): 51-57.
[11]	Li Q L, Zhang D B, Chen M J, Liang W Q, Wei J J, Qi Y P, Yuan Z.2016. Development of japonica photo-sensitive genic male sterile rice lines by editing carbon starved anther using CRISPR/Cas9. J Genet Genom, 43(6): 415-419.
[12]	Li X F, Zhou W J, Ren Y K, Tian X J, Lv T X, Wang Z Y, Fang J, Chu C C, Yang J, Bu Q Y.2017. High-efficiency breeding of early-maturing rice cultivars via CRISPR/Cas9-mediated genome editing.J Genet Genom, 44(3): 175-178.
[13]	Lu G, Moriyama E N.2004. Vector NTI, a balanced all-in-one sequence analysis suite.Brief Bioinform, 5(4): 378-388.
[14]	Ma X L, Zhang Q Y, Zhu Q L, Liu W, Chen Y, Qiu R, Wang B, Yang Z F, Li H Y, Lin Y R, Xie Y Y, Shen R X, Chen S F, Wang Z, Chen Y L, Guo J X, Chen L T, Zhao X C, Dong Z C, Liu Y G.2015. A robust CRISPR/Cas9 system for convenient, high- efficiency multiplex genome editing in monocot and dicot plants.Mol Plant, 8(8): 1274-1284.
[15]	Mikami M, Toki S, Endo M.2015. Comparison of CRISPR/Cas9 expression constructs for efficient targeted mutagenesis in rice.Plant Mol Biol, 88(6): 561-572.
[16]	Murray M G, Thompson W F.1980. Rapid isolation of high molecular weight plant DNA.Nucleic Acids Res, 8(19): 4321-4325.
[17]	Nieves-cordones M, Mohamed S, Tanoi K, Kobayashi N I, Takagi K, Vernet A, Guiderdoni E, Périn C, Sentenac H, Véry A A.2017. Production of low-Cs(+) rice plants by inactivation of the K(+) transporter OsHAK1 with the CRISPR-Cas system.Plant J, 92(1): 43-56.
[18]	Peng B, Sun Y F, Pang R H, Li H L, Song X H, Yuan H Y, Zhang S H, Zhou Q Y, Li Q R, Li D, Song S Z.2016. Study on chalkiness character and endosperm structure of rice grain in different japonica varieties. Acta Agric Zhejiang, 28(11): 1803-1811. (in Chinese with English abstract)
[19]	Shahid S, Begum R, Razzaque S, Jesmin, Seraj Z I.2016. Variability in amylose content of Bangladeshi rice cultivars due to unique SNPs in Waxy allele. J Cereal Sci, 71: 1-9.
[20]	Shen L, Hua Y F, Fu Y P, Jian L, Liu Q, Jiao X Z, Xin G W, Wang J J, Wang X C, Yan C J, Wang K J.2017. Rapid generation of genetic diversity by multiplex CRISPR/Cas9 genome editing in rice.Sci China Life Sci, 60(5): 506-515.
[21]	Sun Y W, Jiao G A, Liu Z P, Zhang X, Li J Y, Guo X P, Du W M, Du J L, Francis F, Zhao Y D, Xia L Q.2017. Generation of high- amylose rice through CRISPR/Cas9-mediated targeted mutagenesis of starch branching enzymes.Front Plant Sci, 8: 298.
[22]	Tang L, Mao B G, Li Y K, Lv Q M, Zhang L P, Chen C Y, He H J, Wang W P, Zeng X F, Shao Y, Pan Y L, Hu Y Y, Peng Y, Fu X Q, Li H Q, Xia S T, Zhao B R.2017. Knockout of OsNramp5 using the CRISPR/Cas9 system produces low Cd-accumulating indica rice without compromising yield. Sci Rep, 7(1): 14438.
[23]	Toru T, Naoko F.2017. Thermal and rheological characteristics of mutant rice starches with widespread variation of amylose content and amylopectin structure.Food Hydrocolloid, 62: 83-93.
[24]	Wamnugu P, Ndjiondjop M N, Furtado A, Henry R.2017. Sequencing of bulks of segregants allows dissection of genetic control of amylose content in rice.Plant Biotechnol J, 16: 100-110.
[25]	Wang B K, Zhang H, Hong R K, Zhang J W, Yang R, Luo Q, Zeng Q C.2018. Wx gene editing via CRISPR/Cas9 system in rice.Chin J Rice Sci, 32(1): 35-42. (in Chinese with English abstract)
[26]	Wang F J, Wang C L, Liu P Q, Lei C L, Hao W, Gao Y, Liu Y G, Zhao K J.2016. Enhanced rice blast resistance by CRISPR/ Cas9-targeted mutagenesis of the ERF transcription factor gene OsERF922. PLoS One, 11(4): e0154027.
[27]	Wang F Q, Fan F J, Li W Q, Zhu J Y, Wang J, Zhong W G, Yang J.2016. Knock out efficiency analysis of Pi21 gene using CRISPR/Cas9 in rice. Chin J Rice Sci, 30(5): 469-478. (in Chinese with English abstract)
[28]	Wang K, Hasjim J, Wu A C, Li E, Henry R J, Gilbert R G.2015. Roles of GBSSI and SSIIa in determining amylose fine structure. Carbohyd Polym, 127: 264-274.
[29]	Wang M G, Mao Y F, Lu Y M, Tao X P, Zhu J K.2017a. Multiplex gene editing in rice using the CRISPR-Cpf1 system.Mol Plant, 10(7): 1011-1013.
[30]	Wang Q X, Zhao H, Jiang J P, Xu J Y, Xie W B, Fu X K, Liu C, He Y Q, Wang G W.2017b. Genetic architecture of natural variation in rice nonphotochemical quenching capacity revealed by genome-wide association study.Front Plant Sci, 8: 1773.
[31]	Wang Y, Geng L Z, Yuan M L, Wei J, Jin C, Li M, Yu K, Zhang Y, Jin H B, Wang E, Chai Z J, Fu X D, Li X G.2017c. Deletion of a target gene in indica rice via CRISPR/Cas9. Plant Cell Rep, 36(8): 1333-1343.
[32]	Wu Y P, Pu C H, Lin H Y, Huang H Y, Huang Y C, Hong C Y, Chang M C, Lin Y R.2015. Three novel alleles of floury endosperm2 (FLO2) confer dull grains with low amylose content in rice. Plant Sci, 233: 44-52.
[33]	Xie Y Y, Niu B X, Long Y M, Li G S, Tang J T, Zhang Y L, Ren D, Liu Y G, Chen L T.2017. Suppression or knockout of SaF/SaM overcomes the Sa-mediated hybrid male sterility in rice. J Integr Plant Biol, 59(9): 669-679.
[34]	Xu R F, Yang Y C, Qin R Y, Li H, Qiu C H, Li L, Wei P C, Yang J B.2016. Rapid improvement of grain weight via highly efficient CRISPR/Cas9-mediated multiplex genome editing in rice.J Genet Genomics, 43(8): 529-532.
[35]	Yang X H, Nong B X, Xia X Z, Zhang Z Q, Zeng Y, Liu K Q, Deng G F, Li D T.2016. Rapid identification of a new gene influencing low amylose content in rice landraces (Oryza sativa L.) using genome-wide association study with specific-locus amplified fragment sequencing. Genome, 60(6): 465-472.
[36]	Yin X J, Biswal A K, Dionora J, Perdigon K M, Balahadia C P, Mazumdar S, Chater C, Lin H C, Coe R A, Kretzschmar T, Guick J E, Quick P W, Bandyopadhyay A.2017. CRISPR-Cas9 and CRISPR-Cpf1 mediated targeting of a stomatal developmental gene EPFL9 in rice. Plant Cell Rep, 36(5): 745-757.
[37]	Zhang H, Xu H, Feng M J, Zhu Y.2018. Suppression of OsMADS7 in rice endosperm stabilizes amylose content under high temperature stress. Plant Biotechnol J, 16(1): 18-26.
[38]	Zhang J S, Zhang H, Botella J R, Zhu J K.2018. Generation of new glutinous rice by CRISPR/Cas9-targeted mutagenesis of the Waxy gene in elite rice varieties. J Integr Plant Biol, 60(5): 369-375.
[39]	Zheng X L, Yang S X, Zhang D W, Zhong Z H, Tang X, Deng K J, Zhou J P, Qi Y P, Zhang Y.2016. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.Plant Cell Rep, 35(7): 1545-1554.
[40]	Zhou H, He M, Li J, Chen L, Huang Z F, Zheng S Y, Zhu L Y, Ni E, Jiang D G, Zhao B R, Zhuang C X.2016. Development of commercial thermo-sensitive genic male sterile rice accelerates hybrid rice breeding using the CRISPR/Cas9-mediatedTMS5 editing system. Sci Rep, 6: 37395.