Rice Science ›› 2019, Vol. 26 ›› Issue (4): 220-228.DOI: 10.1016/j.rsci.2019.04.004
• Orginal Article • Previous Articles Next Articles
Wenhui Wang, Linlin Wang, Yujun Zhu, Yeyang Fan, Jieyun Zhuang()
Received:
2019-02-20
Accepted:
2019-04-26
Online:
2019-07-28
Published:
2019-04-04
Wenhui Wang, Linlin Wang, Yujun Zhu, Yeyang Fan, Jieyun Zhuang. Fine-Mapping of qTGW1.2a, a Quantitative Trait Locus for 1000-Grain Weight in Rice[J]. Rice Science, 2019, 26(4): 220-228.
Add to citation manager EndNote|Ris|BibTeX
Year | Population | Segregating region | Number of lines | |||||
Generation | Name | Marker | Physical position (bp) | NILZS97 | NILMY46 | |||
2014 | BC2F12 | W14-1 | RM212-Wn33252 | 33 053 493-33 252 459 | 20 | 20 | ||
W14-2 | RM212-Wn33252 | 33 053 493-33 252 459 | 20 | 19 | ||||
W14-3 | Wn33252-Wn33304 | 33 252 459-33 304 754 | 40 | 40 | ||||
2016 | BC2F14 | W16-1 | Wn33011-Wn33164 | 33 011 637-33 164 422 | 19 | 14 | ||
W16-2 | Wn33186-Wn33252 | 33 186 760-33 252 459 | 33 | 33 | ||||
2017 | BC2F16 | W17-1 | Wn33011-Wn33186 | 33 011 637-33 186 760 | 33 | 34 | ||
W17-2 | RM212-Wn33252 | 33 053 493-33 252 459 | 33 | 34 | ||||
W17-3 | Wn33186-Wn33252 | 33 186 760-33 252 459 | 34 | 35 | ||||
2018 | BC2F17 | W18-1 | Wn32997-Wn33011 | 32 996 766-33 011 637 | 30 | 30 | ||
W18-2 | RM212-Wn33186 | 33 053 493-33 186 760 | 28 | 28 | ||||
W18-3 | Wn33089-Wn33252 | 33 089 090-33 252 459 | 29 | 30 | ||||
NILZS97 and NILMY46 are near isogenic lines (NILs) having Zhenshan 97 and Milyang 46 homozygous genotypes in the segregating regions, respectively. |
Table 1 Eleven rice populations used for QTL analysis in this study.
Year | Population | Segregating region | Number of lines | |||||
Generation | Name | Marker | Physical position (bp) | NILZS97 | NILMY46 | |||
2014 | BC2F12 | W14-1 | RM212-Wn33252 | 33 053 493-33 252 459 | 20 | 20 | ||
W14-2 | RM212-Wn33252 | 33 053 493-33 252 459 | 20 | 19 | ||||
W14-3 | Wn33252-Wn33304 | 33 252 459-33 304 754 | 40 | 40 | ||||
2016 | BC2F14 | W16-1 | Wn33011-Wn33164 | 33 011 637-33 164 422 | 19 | 14 | ||
W16-2 | Wn33186-Wn33252 | 33 186 760-33 252 459 | 33 | 33 | ||||
2017 | BC2F16 | W17-1 | Wn33011-Wn33186 | 33 011 637-33 186 760 | 33 | 34 | ||
W17-2 | RM212-Wn33252 | 33 053 493-33 252 459 | 33 | 34 | ||||
W17-3 | Wn33186-Wn33252 | 33 186 760-33 252 459 | 34 | 35 | ||||
2018 | BC2F17 | W18-1 | Wn32997-Wn33011 | 32 996 766-33 011 637 | 30 | 30 | ||
W18-2 | RM212-Wn33186 | 33 053 493-33 186 760 | 28 | 28 | ||||
W18-3 | Wn33089-Wn33252 | 33 089 090-33 252 459 | 29 | 30 | ||||
NILZS97 and NILMY46 are near isogenic lines (NILs) having Zhenshan 97 and Milyang 46 homozygous genotypes in the segregating regions, respectively. |
Fig. 1. Distribution of 1000-grain weight in 11 near isogenic line populations of rice.NILZS97 and NILMY46 are near isogenic lines (NILs) having Zhenshan 97 and Milyang 46 homozygous genotypes in the segregating regions, respectively.
Marker | Forward primer (5'-3') | Reverse primer (5'-3') |
---|---|---|
Wn32886 | CGTGTTACTAACCCAGTCAACTCAGG | CAATAGTAGCAGCTAAATTGGCGTTC |
Wn32922 | AAGAAGAACATTTGCTCACAG | TGCAGTCTATTGTTGACCA |
Wn32997 | GTCAACCCAAATGTAGTAAGC | CCGCCGAGGTGAAGTTGTAG |
Wn33011 | TACAATCTACTATCCCGGACT | CTCGCAATTTACATGCAAACT |
Wn33072 | CTGGACAACATCCCCATGCT | GACCGGAAACCAAATACACCC |
Wn33084 | TTGTGACCGCATTAATAAGCC | TAATATTTTATGCGTAACTTG |
Wn33089 | GCTGCCGTGCAATTCGTAGTT | GAGGGATCGCGATGGGGGAGT |
Wn33164 | TACGCACTTGCCCTTAGATGTC | TTTCCTATCTATTTATTGCCCTA |
Wn33186 | AGTTAGTGCAGCAATCTACGTCCT | AGCTCCTCCAGTGACGATACGG |
Wn33252 | GCATGTATCAAAGATTCGATGAGA | TGAAAACTCATGGCTACGCT |
Wn33268 | CGTATATGCTCGTGACTCTG | ATCAGCGAGACAACGACTTCC |
Wn33304 | ATCCAAAATAGTTGAGGGCAT | TTATTTAGCTAGATTATTATAGGCTGG |
Supplemental Table 1 InDel markers used in this study.
Marker | Forward primer (5'-3') | Reverse primer (5'-3') |
---|---|---|
Wn32886 | CGTGTTACTAACCCAGTCAACTCAGG | CAATAGTAGCAGCTAAATTGGCGTTC |
Wn32922 | AAGAAGAACATTTGCTCACAG | TGCAGTCTATTGTTGACCA |
Wn32997 | GTCAACCCAAATGTAGTAAGC | CCGCCGAGGTGAAGTTGTAG |
Wn33011 | TACAATCTACTATCCCGGACT | CTCGCAATTTACATGCAAACT |
Wn33072 | CTGGACAACATCCCCATGCT | GACCGGAAACCAAATACACCC |
Wn33084 | TTGTGACCGCATTAATAAGCC | TAATATTTTATGCGTAACTTG |
Wn33089 | GCTGCCGTGCAATTCGTAGTT | GAGGGATCGCGATGGGGGAGT |
Wn33164 | TACGCACTTGCCCTTAGATGTC | TTTCCTATCTATTTATTGCCCTA |
Wn33186 | AGTTAGTGCAGCAATCTACGTCCT | AGCTCCTCCAGTGACGATACGG |
Wn33252 | GCATGTATCAAAGATTCGATGAGA | TGAAAACTCATGGCTACGCT |
Wn33268 | CGTATATGCTCGTGACTCTG | ATCAGCGAGACAACGACTTCC |
Wn33304 | ATCCAAAATAGTTGAGGGCAT | TTATTTAGCTAGATTATTATAGGCTGG |
Fig. 2. Genotypic compositions of the near isogenic line populations in the target region.A, Three BC2F12 populations. B, Two BC2F14 populations. C, Three BC2F16 populations. D, Three BC2F17 populations.
Supplemental Fig. 2. Distribution of grain length and grain width in 11 near isogenic line populations of rice.A. Three populations in BC2F12. B. Two populations in BC2F14. C. Three populations in BC2F16. D. Three populations in BC2F17.
Generation | Name | Trait | Phenotype (Mean ± SD) | P value | A | R2 (%) | |
NILZS97 | NILMY46 | ||||||
BC2F12 | W14-1 | TGW (g) | 29.30 ± 0.27 | 29.77 ± 0.30 | <0.0001 | 0.23 | 26.15 |
GL (mm) | 8.515 ± 0.040 | 8.519 ± 0.041 | 0.7831 | ||||
GW (mm) | 3.278 ± 0.016 | 3.304 ± 0.020 | <0.0001 | 0.013 | 21.60 | ||
W14-2 | TGW (g) | 29.27 ± 0.27 | 29.99 ± 0.27 | <0.0001 | 0.36 | 41.65 | |
GL (mm) | 8.561 ± 0.042 | 8.576 ± 0.034 | 0.2397 | ||||
GW (mm) | 3.303 ± 0.019 | 3.355 ± 0.019 | <0.0001 | 0.026 | 42.38 | ||
W14-3 | TGW (g) | 29.44 ± 0.28 | 29.33 ± 0.34 | 0.1240 | |||
GL (mm) | 8.545 ± 0.051 | 8.557 ± 0.049 | 0.3004 | ||||
GW (mm) | 3.242 ± 0.021 | 3.226 ± 0.026 | 0.0038 | -0.008 | 6.00 | ||
BC2F14 | W16-1 | TGW (g) | 27.51 ± 0.43 | 28.28 ± 0.37 | <0.0001 | 0.38 | 31.23 |
GL (mm) | 8.261 ± 0.048 | 8.319 ± 0.041 | 0.0013 | 0.029 | 20.34 | ||
GW (mm) | 3.079 ± 0.017 | 3.111 ± 0.016 | <0.0001 | 0.016 | 32.37 | ||
W16-2 | TGW (g) | 27.30 ± 0.46 | 27.32 ± 0.39 | 0.8195 | |||
GL (mm) | 8.302 ± 0.043 | 8.291 ± 0.045 | 0.3423 | ||||
GW (mm) | 3.064 ± 0.021 | 3.065 ± 0.024 | 0.8812 | ||||
BC2F16 | W17-1 | TGW (g) | 26.40 ± 0.32 | 26.99 ± 0.31 | <0.0001 | 0.29 | 35.39 |
GL (mm) | 8.207 ± 0.042 | 8.246 ± 0.038 | 0.0002 | 0.019 | 11.55 | ||
GW (mm) | 3.028 ± 0.019 | 3.070 ± 0.025 | <0.0001 | 0.021 | 35.80 | ||
W17-2 | TGW (g) | 26.38 ± 0.26 | 26.94 ± 0.29 | <0.0001 | 0.28 | 33.59 | |
GL (mm) | 8.195 ± 0.037 | 8.263 ± 0.036 | <0.0001 | 0.034 | 28.15 | ||
GW (mm) | 3.042 ± 0.019 | 3.064 ± 0.021 | <0.0001 | 0.011 | 16.21 | ||
W17-3 | TGW (g) | 26.77 ± 0.23 | 26.78 ± 0.23 | 0.8769 | |||
GL (mm) | 8.306 ± 0.027 | 8.302 ± 0.031 | 0.5432 | ||||
GW (mm) | 3.031 ± 0.016 | 3.031 ± 0.014 | 0.9496 | ||||
BC2F17 | W18-1 | TGW (g) | 27.44 ± 0.21 | 27.46 ± 0.18 | 0.7023 | ||
GL (mm) | 8.323 ± 0.023 | 8.315 ± 0.025 | 0.2390 | ||||
GW (mm) | 3.146 ± 0.027 | 3.149 ± 0.023 | 0.5819 | ||||
W18-2 | TGW (g) | 27.64 ± 0.34 | 28.17 ± 0.24 | <0.0001 | 0.26 | 36.65 | |
GL (mm) | 8.340 ± 0.036 | 8.352 ± 0.025 | 0.1796 | ||||
GW (mm) | 3.140 ± 0.031 | 3.182 ± 0.025 | <0.0001 | 0.021 | 25.49 | ||
W18-3 | TGW (g) | 28.15 ± 0.18 | 28.19 ± 0.13 | 0.3866 | |||
GL (mm) | 8.373 ± 0.027 | 8.367 ± 0.023 | 0.4148 | ||||
GW (mm) | 3.170 ± 0.016 | 3.169 ± 0.016 | 0.8698 | ||||
TGW, 1000-grain weight; GL, Grain length; GW, Grain width; A, Additive effect of replacing a Zhenshan 97 allele with a Milyang 46 allele; R2, Proportion of phenotypic variance explained by the QTL effect. |
Table 3 Phenotypic difference between the two genotypic groups in each population.
Generation | Name | Trait | Phenotype (Mean ± SD) | P value | A | R2 (%) | |
NILZS97 | NILMY46 | ||||||
BC2F12 | W14-1 | TGW (g) | 29.30 ± 0.27 | 29.77 ± 0.30 | <0.0001 | 0.23 | 26.15 |
GL (mm) | 8.515 ± 0.040 | 8.519 ± 0.041 | 0.7831 | ||||
GW (mm) | 3.278 ± 0.016 | 3.304 ± 0.020 | <0.0001 | 0.013 | 21.60 | ||
W14-2 | TGW (g) | 29.27 ± 0.27 | 29.99 ± 0.27 | <0.0001 | 0.36 | 41.65 | |
GL (mm) | 8.561 ± 0.042 | 8.576 ± 0.034 | 0.2397 | ||||
GW (mm) | 3.303 ± 0.019 | 3.355 ± 0.019 | <0.0001 | 0.026 | 42.38 | ||
W14-3 | TGW (g) | 29.44 ± 0.28 | 29.33 ± 0.34 | 0.1240 | |||
GL (mm) | 8.545 ± 0.051 | 8.557 ± 0.049 | 0.3004 | ||||
GW (mm) | 3.242 ± 0.021 | 3.226 ± 0.026 | 0.0038 | -0.008 | 6.00 | ||
BC2F14 | W16-1 | TGW (g) | 27.51 ± 0.43 | 28.28 ± 0.37 | <0.0001 | 0.38 | 31.23 |
GL (mm) | 8.261 ± 0.048 | 8.319 ± 0.041 | 0.0013 | 0.029 | 20.34 | ||
GW (mm) | 3.079 ± 0.017 | 3.111 ± 0.016 | <0.0001 | 0.016 | 32.37 | ||
W16-2 | TGW (g) | 27.30 ± 0.46 | 27.32 ± 0.39 | 0.8195 | |||
GL (mm) | 8.302 ± 0.043 | 8.291 ± 0.045 | 0.3423 | ||||
GW (mm) | 3.064 ± 0.021 | 3.065 ± 0.024 | 0.8812 | ||||
BC2F16 | W17-1 | TGW (g) | 26.40 ± 0.32 | 26.99 ± 0.31 | <0.0001 | 0.29 | 35.39 |
GL (mm) | 8.207 ± 0.042 | 8.246 ± 0.038 | 0.0002 | 0.019 | 11.55 | ||
GW (mm) | 3.028 ± 0.019 | 3.070 ± 0.025 | <0.0001 | 0.021 | 35.80 | ||
W17-2 | TGW (g) | 26.38 ± 0.26 | 26.94 ± 0.29 | <0.0001 | 0.28 | 33.59 | |
GL (mm) | 8.195 ± 0.037 | 8.263 ± 0.036 | <0.0001 | 0.034 | 28.15 | ||
GW (mm) | 3.042 ± 0.019 | 3.064 ± 0.021 | <0.0001 | 0.011 | 16.21 | ||
W17-3 | TGW (g) | 26.77 ± 0.23 | 26.78 ± 0.23 | 0.8769 | |||
GL (mm) | 8.306 ± 0.027 | 8.302 ± 0.031 | 0.5432 | ||||
GW (mm) | 3.031 ± 0.016 | 3.031 ± 0.014 | 0.9496 | ||||
BC2F17 | W18-1 | TGW (g) | 27.44 ± 0.21 | 27.46 ± 0.18 | 0.7023 | ||
GL (mm) | 8.323 ± 0.023 | 8.315 ± 0.025 | 0.2390 | ||||
GW (mm) | 3.146 ± 0.027 | 3.149 ± 0.023 | 0.5819 | ||||
W18-2 | TGW (g) | 27.64 ± 0.34 | 28.17 ± 0.24 | <0.0001 | 0.26 | 36.65 | |
GL (mm) | 8.340 ± 0.036 | 8.352 ± 0.025 | 0.1796 | ||||
GW (mm) | 3.140 ± 0.031 | 3.182 ± 0.025 | <0.0001 | 0.021 | 25.49 | ||
W18-3 | TGW (g) | 28.15 ± 0.18 | 28.19 ± 0.13 | 0.3866 | |||
GL (mm) | 8.373 ± 0.027 | 8.367 ± 0.023 | 0.4148 | ||||
GW (mm) | 3.170 ± 0.016 | 3.169 ± 0.016 | 0.8698 | ||||
TGW, 1000-grain weight; GL, Grain length; GW, Grain width; A, Additive effect of replacing a Zhenshan 97 allele with a Milyang 46 allele; R2, Proportion of phenotypic variance explained by the QTL effect. |
Locus name | Gene product name |
---|---|
LOC_Os01g57120 | Transposon protein, putative, unclassified |
LOC_Os01g57130 | Retrotransposon protein, putative, Ty3-gypsy subclass, expressed |
LOC_Os01g57140 | Hypothetical protein |
LOC_Os01g57150 | SR protein related family member, putative, expressed |
LOC_Os01g57160 | Transposon protein, putative, CACTA, En/Spm sub-class, expressed |
LOC_Os01g57170 | Expressed protein, uncharacterized |
LOC_Os01g57180 | Hypothetical protein |
LOC_Os01g57190 | Transposon protein, putative, unclassified, expressed |
LOC_Os01g57210 | Katanin p80 WD40 repeat-containing subunit B1 homolog 1, putative, expressed |
LOC_Os01g57220 | Secretory carrier-associated membrane protein, putative, expressed |
LOC_Os01g57230 | BTBN1 - Bric-a-Brac, Tramtrack, Broad Complex BTB domain with non-phototropic hypocotyl 3 NPH3 and coiled-coil domains, expressed |
LOC_Os01g57240 | Expressed protein, uncharacterized |
LOC_Os01g57250 | Expressed protein, uncharacterized |
Supplemental Table 2 Supplemental Table 2. Annotated genes in the 77.5-kb region for qTGW1.2a.
Locus name | Gene product name |
---|---|
LOC_Os01g57120 | Transposon protein, putative, unclassified |
LOC_Os01g57130 | Retrotransposon protein, putative, Ty3-gypsy subclass, expressed |
LOC_Os01g57140 | Hypothetical protein |
LOC_Os01g57150 | SR protein related family member, putative, expressed |
LOC_Os01g57160 | Transposon protein, putative, CACTA, En/Spm sub-class, expressed |
LOC_Os01g57170 | Expressed protein, uncharacterized |
LOC_Os01g57180 | Hypothetical protein |
LOC_Os01g57190 | Transposon protein, putative, unclassified, expressed |
LOC_Os01g57210 | Katanin p80 WD40 repeat-containing subunit B1 homolog 1, putative, expressed |
LOC_Os01g57220 | Secretory carrier-associated membrane protein, putative, expressed |
LOC_Os01g57230 | BTBN1 - Bric-a-Brac, Tramtrack, Broad Complex BTB domain with non-phototropic hypocotyl 3 NPH3 and coiled-coil domains, expressed |
LOC_Os01g57240 | Expressed protein, uncharacterized |
LOC_Os01g57250 | Expressed protein, uncharacterized |
[1] | Bai X F, Wu B, Xing Y Z.2012. Yield-related QTLs and their applications in rice genetic improvement.J Integr Plant Biol, 54(5): 300-311. |
[2] | Chen J Y, Zhang H W, Zhang H L, Ying J Z, Ma L Y, Zhuang J Y.2018. Natural variation atqHd1 affects heading date acceleration at high temperatures with pleiotropism for yield traits in rice. BMC Plant Biol, 18: 112. |
[3] | Chen X, Temnykh S, Xu Y, Cho Y G, McCouch S R.1997. Development of a microsatellite framework map providing genome-wide coverage in rice (Oryza sativa L.). Theor Appl Genet, 95(4): 553-567. |
[4] | Dai W M, Zhang K Q, Wu J R, Wang L, Duan B W, Zheng K L, Cai R, Zhuang J Y.2008. Validating a segment on the short arm of chromosome 6 responsible for genetic variation in the hull silicon content and yield traits of rice.Euphytica, 160(3): 317-324. |
[5] | Dong Q, Zhang Z H, Wang L L, Zhu Y J, Fan Y Y, Mou T M, Ma L Y, Zhuang J Y.2018. Dissection and fine-mapping of two QTL for grain size linked in a 460-kb region on chromosome 1 of rice. Rice, 11(1): 44. |
[6] | Duan P G, Ni S, Wang J M, Zhang B L, Xu R, Wang Y X, Chen H Q, Zhu X D, Li Y H.2015. Regulation ofOsGRF4 by OsmiR396 controls grain size and yield in rice. Nat Plants, 2: 15203. |
[7] | Duan P G, Xu J S, Zeng D L, Zhang B L, Geng M F, Zhang G Z, Huang K, Huang L J, Xu R, Ge S, Qian Q, Li Y H.2017. Natural variation in the promoter ofGSE5 contributes to grain size diversity in rice. Mol Plant, 10(5): 685-694. |
[8] | Fan C C, Xing Y Z, Mao H L, Lu T T, Han B, Xu C G, Li X H, Zhang Q F.2006. GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor Appl Genet, 112(6): 1164-1171. |
[9] | Hu J, Wang Y X, Fang Y X, Zeng L J, Xu J, Yu H P, Shi Z Y, Pan J J, Zhang D, Kang S J, Zhu L, Dong G J, Guo L B, Zeng D L, Zhang G H, Xie L H, Xiong G S, Li J Y, Qian Q.2015. A rare allele ofGS2 enhances grain size and grain yield in rice. Mol Plant, 8(10): 1455-1465. |
[10] | Hu Z J, Lu S J, Wang M J, He H H, Sun L, Wang H R, Liu X H, Jiang L, Sun J L, Xin X Y, Kong W, Chu C C, Xue H W, Yang J S, Luo X J, Liu J X.2018. A novel QTL qTGW3 encodes the GSK3/SHAGGY-like kinase OsGSK5/OsSK41 that interacts with OsARF4 to negatively regulate grain size and weight in rice. Mol Plant, 11(5): 736-749. |
[11] | Huang R Y, Jiang L R, Zheng J S, Wang T S, Wang H C, Huang Y M, Hong Z L.2013. Genetic bases of rice grain shape: So many genes, so little known.Trends Plant Sci, 18(4): 218-226. |
[12] | Ishimaru K, Hirotsu N, Madoka Y, Murakami N, Hara N, Onodera H, Kashiwagi T, Ujiie K, Shimizu B, Onishi A, Miyagawa H, Katoh E.2013. Loss of function of the IAA-glucose hydrolase geneTGW6 enhances rice grain weight and increases yield. Nat Genet, 45(6): 707-711. |
[13] | Li N, Xu R, Duan P G, Li Y H.2018. Control of grain size in rice.Plant Reprod, 31(3): 237-251. |
[14] | Li Y B, Fan C C, Xing Y Z, Jiang Y H, Luo L J, Sun L, Shao D, Xu C J, Li X H, Xiao J H, He Y Q, Zhang Q F.2011. Natural variation in GS5 plays an important role in regulating grain size and yield in rice. Nat Genet, 43(12): 1266-1269. |
[15] | Liu J F, Chen J, Zheng X M, Wu F Q, Lin Q B, Heng Y Q, Tian P, Cheng Z J, Yu X W, Zhou K N, Zhang X, Guo X P, Wang J L, Wang H Y, Wan J M.2017. GW5 acts in the brassinosteroid signalling pathway to regulate grain width and weight in rice. Nat Plants, 3: 17043. |
[16] | Liu Q, Han R X, Wu K, Zhang J Q, Ye Y F, Wang S S, Chen J F, Pan Y J, Li Q, Xu X P, Zhou J W, Tao D Y, Wu Y J, Fu X D.2018. G-protein βγ subunits determine grain size through interaction with MADS-domain transcription factors in rice.Nat Commun, 9: 852. |
[17] | Mackay T F C, Stone E A, Ayroles J F.2009. The genetics of quantitative traits: Challenges and prospects.Nat Rev Genet, 10(8): 565-577. |
[18] | Matsubara K, Ogiso-Tanaka E, Hori K, Ebana K, Ando T, Yano M.2012. Natural variation inHd17, a homolog of Arabidopsis ELF3 that is involved in rice photoperiodic flowering. Plant Cell Physiol, 53(4): 709-716. |
[19] | Qi L, Ding Y B, Zheng X M, Xu R, Zhang L Z, Wang Y Y, Wang X N, Zhang L F, Cheng Y L, Yang Q W.2018. Fine mapping and identification of a novel locusqGL12.2 control grain length in wild rice(Oryza rufipogon Griff.). Theor Appl Genet, 131(7): 1497-1508. |
[20] | Qi P, Lin Y S, Song X J, Shen J B, Huang W, Shan J X, Zhu M Z, Jiang L, Gao J P, Lin H X.2012. The novel quantitative trait locusGL3.1 controls rice grain size and yield by regulating Cyclin-T1;3. Cell Res, 22(12): 1666-1680. |
[21] | SAS Institute Inc.1999. SAS/STAT User’s Guide . Cary:SAS Institute. |
[22] | Shao G N, Tang S Q, Luo J, Jiao G A, Wei X J, Tang A, Wu J L, Zhuang J Y, Hu P S.2010. Mapping ofqGL7-2, a grain length QTL on chromosome 7 of rice. J Genet Genom, 37(8): 523-531. |
[23] | Si L Z, Chen J Y, Huang X H, Gong H, Luo J H, Hou Q Q, Zhou T Y, Lu T T, Zhu J J, Shangguan Y Y, Chen E W, Gong G X, Zhao Q, Jing Y F, Zhao Y, Li Y, Cui L L, Fan D L, Lu Y Q, Weng Q J, Wang Y C, Zhan Q L, Liu K Y, Wei X H, An K, An G, Han B.2016. OsSPL13 controls grain size in cultivated rice. Nat Genet, 48: 447-456. |
[24] | Song X J, Huang W, Shi M, Zhu M Z, Lin H X.2007. A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase.Nat Genet, 39: 623-630. |
[25] | Song X J, Kuroha T, Ayano M, Furuta T, Nagai K, Komeda N, Segami S, Miura K, Ogawa D, Kamura T, Suzuki T, Higashiyama T, Yamasaki M, Mori H, Inukai Y, Wu J Z, Kitano H, Sakakibara H, Jacobsen S E, Ashikari M.2015. Rare allele of a previously unidentified histone H4 acetyltransferase enhances grain weight, yield, and plant biomass in rice.Proc Natl Acad Sci USA, 112(1): 76-81. |
[26] | Wang L L, Chen Y Y, Guo L, Zhang H W, Fan Y Y, Zhuang J Y.2015. Dissection ofqTGW1.2 to three QTLs for grain weight and grain size in rice(Oryza sativa L.). Euphytica, 202(1): 119-127. |
[27] | Wang S K, Wu K, Yuan Q B, Liu X Y, Liu Z B, Lin X, Y Zeng R Z, Zhu H T, Dong G J, Qian Q, Zhang G Q, Fu X D.2012. Control of grain size, shape and quality byOsSPL16 in rice. Nat Genet, 44(8): 950-954. |
[28] | Wang S K, Li S, Liu Q, Wu K, Zhang J Q, Wang S S, Wang Y, Chen X B, Zhang Y, Gao C X, Wang F, Huang H X, Fu X D.2015. TheOsSPL16-GW7 regulatory module determines grain shape and simultaneously improves rice yield and grain quality. Nat Genet, 47(8): 949-954. |
[29] | Wang Y X, Xiong G S, Hu J, Jiang L, Yu H, Xu J, Fang Y X, Zeng L J, Xu E B, Xu J, Ye W J, Meng X B, Liu R F, Chen H Q, Jing Y H, Wang Y H, Zhu X D, Li J Y, Qian Q.2015. Copy number variation at theGL7 locus contributes to grain size diversity in rice. Nat Genet, 47(8): 944-948. |
[30] | Wu W G, Liu X Y, Wang M H, Meyer R S, Luo X J, Ndjiondjop M N, Tan L B, Zhang J W, Wu J Z, Cai H W, Sun C Q, Wang X K, Wing R A, Zhu Z F.2017. A single-nucleotide polymorphism causes smaller grain size and loss of seed shattering during African rice domestication.Nat Plants, 3: 17064. |
[31] | Wu W X, Zheng X M, Lu G W, Zhong Z Z, Gao H, Chen L P, Wu C Y, Wang H J, Wang Q, Zhou K N, Wang J L, Wu F Q, Zhang X, Guo X P, Cheng Z J, Lei C L, Lin Q B, Jiang L, Wang H Y, Ge S, Wan J M.2013. Association of functional nucleotide polymorphisms at DTH2 with the northward expansion of rice cultivation in Asia. Proc Natl Acad Sci USA, 110(8): 2775-2780. |
[32] | Xia D, Zhou H, Liu R J, Dan W H, Li P B, Wu B, Chen J X, Wang L Q, Gao G J, Zhang Q L, He Y Q.2018. GL3.3, a novel QTL encoding a GSK3/SHAGGY-like kinase, epistatically interacts with GS3 to form extra-long grains in rice. Mol Plant, 11(5): 754-756. |
[33] | Xu C J, Liu Y, Li Y B, Xu X D, Xu C G, Li X H, Xiao J H, Zhang Q F.2015. Differential expression ofGS5 regulates grain size in rice. J Exp Bot, 66(9): 2611-2623. |
[34] | Ying J Z, Ma M, Bai C, Huang X H, Liu J L, Fang Y Y, Song X J.2018. TGW3, a major QTL that negatively modulates grain length and weight in rice. Mol Plant, 11(5): 750-753. |
[35] | Yu J P, Xiong H Y, Zhu X Y, Zhang H L, Li H H, Miao J L, Wang W S, Tang Z S, Zhang Z Y, Yao G X, Zhang Q, Pan Y H, Wang X, Rashid M A R, Li J J, Gao Y M, Li Z K, Yang W C, Fu X D, Li Z C.2017. OsLG3 contributing to rice grain length and yield was mined by Ho-LAMap. BMC Biol, 15: 28. |
[36] | Yu J P, Miao J L, Zhang Z Y, Xiong H Y, Zhu X Y, Sun X M, Pan Y H, Liang Y T, Zhang Q, Rashid M A R, Li J J, Zhang H L, Li Z C.2018. Alternative splicing of OsLG3b controls grain length and yield in japonica rice. Plant Biotechnol J, 16(9): 1667-1678. |
[37] | Zhang H W, Fan Y Y, Zhu Y J, Chen J Y, Yu S B, Zhuang J Y.2016. Dissection of theqTGW1.1 region into two tightly-linked minor QTLs having stable effects for grain weight in rice. BMC Genet, 17(1): 98. |
[38] | Zhang X J, Wang J F, Huang J, Lan H X, Wang C L, Yin C F, Wu Y Y, Tang H J, Qian Q, Li J Y, Zhang H S.2012. Rare allele ofOsPPKL1 associated with grain length causes extra-large grain and a significant yield increase in rice. Proc Natl Acad Sci USA, 109: 21534-21539. |
[39] | Zhao D S, Li Q F, Zhang C Q, Zhang C, Yang Q Q, Pan L X, Ren X Y, Lu J, Gu M H, Liu Q Q.2018. GS9 acts as a transcriptional activator to regulate rice grain shape and appearance quality. Nat Commun, 9: 1240. |
[40] | Zheng K L, Huang N, Bennett J, Khush G S.1995. PCR-ased marker-assisted selection in rice breeding. IRRI Discussion Paper Series No. 12. Los Banos, the Phillipines:International Rice Research Institute. |
[41] | Zhu Y J, Fan Y Y, Wang K, Huang D R, Liu W Z, Ying J Z, Zhuang J Y.2017. Rice Flowering LocusT1 plays an important role in heading date influencing yield traits in rice. Sci Rep, 7: 4918. |
[42] | Zuo J R, Li J Y.2014. Molecular genetic dissection of quantitative trait loci regulating rice grain size.Annu Rev Genet, 48: 99-118. |
[1] | Prathap V, Suresh KUMAR, Nand Lal MEENA, Chirag MAHESHWARI, Monika DALAL, Aruna TYAGI. Phosphorus Starvation Tolerance in Rice Through a Combined Physiological, Biochemical and Proteome Analysis [J]. Rice Science, 2023, 30(6): 8-. |
[2] | Serena REGGI, Elisabetta ONELLI, Alessandra MOSCATELLI, Nadia STROPPA, Matteo Dell’ANNO, Kiril PERFANOV, Luciana ROSSI. Seed-Specific Expression of Apolipoprotein A-IMilano Dimer in Rice Engineered Lines [J]. Rice Science, 2023, 30(6): 6-. |
[3] | Sundus ZAFAR, XU Jianlong. Recent Advances to Enhance Nutritional Quality of Rice [J]. Rice Science, 2023, 30(6): 4-. |
[4] | Kankunlanach KHAMPUANG, Nanthana CHAIWONG, Atilla YAZICI, Baris DEMIRER, Ismail CAKMAK, Chanakan PROM-U-THAI. Effect of Sulfur Fertilization on Productivity and Grain Zinc Yield of Rice Grown under Low and Adequate Soil Zinc Applications [J]. Rice Science, 2023, 30(6): 9-. |
[5] | FAN Fengfeng, CAI Meng, LUO Xiong, LIU Manman, YUAN Huanran, CHENG Mingxing, Ayaz AHMAD, LI Nengwu, LI Shaoqing. Novel QTLs from Wild Rice Oryza longistaminata Confer Rice Strong Tolerance to High Temperature at Seedling Stage [J]. Rice Science, 2023, 30(6): 14-. |
[6] | LIN Shaodan, YAO Yue, LI Jiayi, LI Xiaobin, MA Jie, WENG Haiyong, CHENG Zuxin, YE Dapeng. Application of UAV-Based Imaging and Deep Learning in Assessment of Rice Blast Resistance [J]. Rice Science, 2023, 30(6): 10-. |
[7] | Md. Forshed DEWAN, Md. AHIDUZZAMAN, Md. Nahidul ISLAM, Habibul Bari SHOZIB. Potential Benefits of Bioactive Compounds of Traditional Rice Grown in South and South-East Asia: A Review [J]. Rice Science, 2023, 30(6): 5-. |
[8] | Raja CHAKRABORTY, Pratap KALITA, Saikat SEN. Phenolic Profile, Antioxidant, Antihyperlipidemic and Cardiac Risk Preventive Effect of Chakhao Poireiton (A Pigmented Black Rice) in High-Fat High-Sugar induced Rats [J]. Rice Science, 2023, 30(6): 11-. |
[9] | LI Qianlong, FENG Qi, WANG Heqin, KANG Yunhai, ZHANG Conghe, DU Ming, ZHANG Yunhu, WANG Hui, CHEN Jinjie, HAN Bin, FANG Yu, WANG Ahong. Genome-Wide Dissection of Quan 9311A Breeding Process and Application Advantages [J]. Rice Science, 2023, 30(6): 7-. |
[10] | JI Dongling, XIAO Wenhui, SUN Zhiwei, LIU Lijun, GU Junfei, ZHANG Hao, Tom Matthew HARRISON, LIU Ke, WANG Zhiqin, WANG Weilu, YANG Jianchang. Translocation and Distribution of Carbon-Nitrogen in Relation to Rice Yield and Grain Quality as Affected by High Temperature at Early Panicle Initiation Stage [J]. Rice Science, 2023, 30(6): 12-. |
[11] | Nazaratul Ashifa Abdullah Salim, Norlida Mat Daud, Julieta Griboff, Abdul Rahim Harun. Elemental Assessments in Paddy Soil for Geographical Traceability of Rice from Peninsular Malaysia [J]. Rice Science, 2023, 30(5): 486-498. |
[12] | Ammara Latif, Sun Ying, Pu Cuixia, Noman Ali. Rice Curled Its Leaves Either Adaxially or Abaxially to Combat Drought Stress [J]. Rice Science, 2023, 30(5): 405-416. |
[13] | Liu Qiao, Qiu Linlin, Hua Yangguang, Li Jing, Pang Bo, Zhai Yufeng, Wang Dekai. LHD3 Encoding a J-Domain Protein Controls Heading Date in Rice [J]. Rice Science, 2023, 30(5): 437-448. |
[14] | Lu Xuedan, Li Fan, Xiao Yunhua, Wang Feng, Zhang Guilian, Deng Huabing, Tang Wenbang. Grain Shape Genes: Shaping the Future of Rice Breeding [J]. Rice Science, 2023, 30(5): 379-404. |
[15] | Zhang Guomei, Li Han, Liu Shanshan, Zhou Xuming, Lu Mingyang, Tang Liang, Sun Lihua. Water Extract of Rice False Smut Balls Activates Nrf2/HO-1 and Apoptosis Pathways, Causing Liver Injury [J]. Rice Science, 2023, 30(5): 473-485. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||