Identification of Major Locus Bph35 Resistance to Brown Planthopper in Rice

doi:10.1016/j.rsci.2020.04.006

Abstract

Abstract:

An introgression line RBPH660, derived from wild rice Oryza rufipogon, showed stable resistance to brown planthopper (BPH). Segregation analysis indicated BPH resistance of RBPH660 was controlled by multiple genes/QTLs. By using the bulked segregant analysis (BSA)-seq method, two genomic regions harboring QTLs resistance to BPH were identified from 1.20 to 16.70 Mb on chromosome 4 and from 10.20 to 12.60 Mb on chromosome 9 in RBPH660, respectively. A major resistance locus, designated as Bph35 accounting for 51.27% of the phenotypic variation with a LOD score of 42.51, was mapped to the candidate region of chromosome 4 between InDel (insertion-deletion) markers PSM16 and R4M13. For fine mapping of Bph35, one simple sequence repeat and three newly developed InDel markers were used to screen the recombinants. Finally, the Bph35 locus was delimited in the region from 6.28 to 6.93 Mb and there were 18 predicted protein-encoding genes with a total of 114 non-synonymous single nucleotide polymorphism (SNP) variant sites between the resistant and susceptible parents. Out of these genes, Os04g0193950, encoding a putative NB-ARC (nucleotide- binding adaptor shared by APAF-1, R proteins and CED-4) and LRR (leucine-rich repeat) domain protein with nine non-synonymous SNP substitutions in its coding sequence regions, might be the candidate gene for Bph35. These findings would facilitate the map-based cloning of the Bph35 gene and development of resistant varieties against BPH in rice.

Key words: rice, brown planthopper, Bph35, bulked segregant analysis (BSA)-seq method, gene mapping

Yuexiong Zhang, Gang Qin, Qianqian Ma, Minyi Wei, Xinghai Yang, Zengfeng Ma, Haifu Liang, Chi Liu, Zhenjing Li, Fang Liu, Dahui Huang, Rongbai Li. Identification of Major Locus Bph35 Resistance to Brown Planthopper in Rice[J]. Rice Science, 2020, 27(3): 237-245.

Figures/Tables 5

References 52

[1]	Abe A, Kosugi S, Yoshida K, Natsume S, Takagi H, Kanzaki H, Matsumura H, Yoshida K, Mitsuoka C, Tamiru M, Innan H, Cano L, Kamoun S, Terauchi R.2012. Genome sequencing reveals agronomically important loci in rice using MutMap.Nat Biotechnol, 30(2): 174-178.
[2]	Cabauatan P Q, Cabunagan R C, Choi I R.2009. Rice viruses transmitted by the brown planthopper Nilaparvata lugens Stål. In: Heong K L, Hardy B. Planthoppers: New Threats to the Sustainability of Intensive Rice Production Systems in Asia. Los Baños, the Philippine: International Rice Research Institute: 357-368.
[3]	Chen X, Temnykh S, Xu Y, Cho Y G, McCouch S R.1997. Development of a microsatellite framework map providing genome- wide coverage in rice (Oryza sativa L.). Theor Appl Genet, 95(4): 553-567.
[4]	Cheng X Y, Zhu L L, He G C.2013. The understanding of molecular interaction between rice and brown planthopper.Mol Plant, 6: 621-634.
[5]	Deen R, Ramesh K, Gautam S K, Rao K Y, Lakshmi V J, Viraktamath B C, Brar D S, Ram T.2010. Identification of new gene for BPH resistance introgressed from O. rufipogon. Rice Genet Newsl, 25: 70-71.
[6]	Du B, Zhang W L, Liu B F, Hu J, Wei Z, Shi Z Y, He R F, Zhu L L, Chen R Z, Han B, He G C.2009. Identification and characterization ofBph14, a gene conferring resistance to brown planthopper in rice. Proc Natl Acad Sci USA, 106: 22163-22168.
[7]	Guo J P, Xu C X, Wu D, Zhao Y, Qiu Y F, Wang X X, Ouyang Y D, Cai B D, Liu X, Jing S L, Shangguan X X, Wang H Y, Ma Y H, Hu L, Wu Y, Shi S J, Wang W L, Zhu L L, Xu X, Chen R Z, Feng Y Q, Du B, He G C.2018. Bph6 encodes an exocyst- localized protein and confers broad resistance to planthoppers in rice. Nat Genet, 50: 297-306.
[8]	Hou L Y, Yu P, Xu Q, Yan X P, Yu H Y, Wang Y P, Wang C H, Wan G, Tang S X, Peng S T, Wei X H.2011. Genetic analysis and preliminary mapping of two recessive resistance genes to brown planthopper,Nilaparvata lugens Stal in rice. Rice Sci, 18(3): 238-242.
[9]	Hu J, Xiao C, Cheng M X, Gao G J, Zhang Q L, He Y Q.2015a. Fine mapping and pyramiding of brown planthopper resistance genesQBph3 and QBph4 in an introgression line from wild rice O. officinalis. Mol Breeding, 35: 3-12.
[10]	Hu J, Xiao C, Cheng M X, Gao G J, Zhang Q L, He Y Q.2015b. A new finely mappedOryza australiensis derived QTL in rice confers resistance to brown planthopper. Gene, 561(1): 132-137.
[11]	Hu J, Xiao C, He Y Q.2016. Recent progress on the genetics and molecular breeding of brown planthopper resistance in rice.Rice, 9: 30.
[12]	Hu J, Chang X Y, Zou L, Tang W Q, Wu W R.2018. Identification and fine mapping ofBph33, a new brown planthopper resistance gene in rice(Oryza sativa L.). Rice, 11: 55.
[13]	Huang D, Qiu Y, Zhang Y, Huang F, Meng J, Wei S, Li R, Chen B.2013. Fine mapping and characterization ofBPH27, a brown planthopper resistance gene from wild rice(Oryza rufipogon Griff.). Theor Appl Genet, 126(1): 219-229.
[14]	Huang X H, Kurata N, Wei X H, Wang Z X, Wang A H, Zhao Q, Zhao Y, Liu K Y, Lu H Y, Li W J, Guo Y L, Lu Y Q, Zhou C C, Fan D L, Weng Q J, Zhu C R, Huang T, Zhang L, Wang Y C, Feng L, Furuumi H, Kubo T, Miyabayashi T, Yuan X P, Xu Q, Dong G J, Zhan Q L, Li C Y, Fujiyama A, Toyoda A, Lu T T, Feng Q, Qian Q, Li J Y, Han B.2012. A map of rice genome variation reveals the origin of cultivated rice.Nature, 490: 497-501.
[15]	Huang Z, He G C, Shu L H, Li X H, Zhang Q F.2001. Identification and mapping of two brown planthopper resistance genes in rice.Theor Appl Genet, 102: 929-934.
[16]	IRRI.1996. Standard Evaluation Systems for Rice. Manila, the Phillipines: IRRI.
[17]	Ishii T, Brar D S, Multani D S, Khush G S.1994. Molecular tagging of genes for brown planthopper resistance and earliness introgressed fromOryza australiensis into cultivated rice, O. sativa. Genome, 37(2): 217-221.
[18]	Jena K K, Jeung J U, Lee J H, Choi H C, Brar D S.2006. High resolution mapping of a new brown planthopper (BPH) resistance gene,Bph18(t), and marker-assisted selection for BPH resistance in rice (Oryza sativa L.). Theor Appl Genet, 112(2): 288-297.
[19]	Ji H, Kim S R, Kim Y H, Suh J P, Park H M, Sreenivasulu N, Misra G, Kim S M, Hechanova S L, Kim H, Lee G S, Yoon U H, Kim T H, Lim H, Suh S C, Yang J, An G, Jena K K.2016. Map-based cloning and characterization of theBPH18 gene from wild rice conferring resistance to brown planthopper (BPH) insect pest. Sci Rep, 6: 34376.
[20]	Jiang H Y, Zeng G, Hao M, Huang X G, Xiao Y H.2019. Identification of brown planthopper resistance genes in broad-spectrum blast resistant rice germplasm 75-1-127 and its molecular marker-assisted selection breeding.Chin J Rice Sci, 33(3): 227-234. (in Chinese with English abstract)
[21]	Jing S L, Zhao Y, Du B, Chen R Z, Zhu L L, He G C.2017. Genomics of interaction between the brown planthopper and rice.Curr Opin Insect Sci, 19: 82-87.
[22]	Khush G S, Karim A R, Angeles E R.1985. Genetics of resistance of rice cultivar ARC10550 to Bangladesh brown planthopper biotype.J Genet, 64(2): 121-125.
[23]	Kumar K, Sarao P S, Bhatia D, Neelam K, Kaur A, Mangat G S, Brar D S, Singh K.2018. High resolution genetic mapping of a novel brown planthopper resistance locus,Bph34 in Oryza sativa L. × Oryza nivara(Sharma & Shastry) derived interspecific F2 population. Theor Appl Genet, 131(5): 1163-1171.
[24]	Li H, Durbin R.2009. Fast and accurate short read alignment with Burrows-Wheeler transform.Bioinformatics, 25(14): 1754-1760.
[25]	Liu G Q, Yan H H, Fu Q, Qian Q, Zhang Z T, Zhai W X, Zhu L H.2001. Mapping of a new gene for brown planthopper resistance in cultivated rice introgressed fromOryza eichingeri. Chin Sci Bull, 46: 1459-1462.
[26]	Liu Y Q, Wu H, Chen H, Liu Y L, He J, Kang H Y, Sun Z Q, Pan G, Wang Q, Hu J L, Zhou F, Zhou K N, Zheng X M, Ren Y L, Chen L M, Wang Y H, Zhao Z G, Lin Q B, Wu F Q, Zhang X, Guo X P, Cheng X N, Jiang L, Wu C Y, Wang H Y, Wan J M.2015. A gene cluster encoding lectin receptor kinases confers broad-spectrum and durable insect resistance in rice.Nat Biotechnol, 33(3): 334-335.
[27]	Lv W T, Du B, Shangguan X X, Zhao Y, PanY F, Zhu L L, He Y Q, He G C.2014. BAC and RNA sequencing reveal the brown planthopper resistance geneBPH15 in a recombination cold spot that mediates a unique defense mechanism. BMC Genom, 15(1): 674.
[28]	McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler S, Daly M, DePristo M A.2010. The genome analysis toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data.Genom Res, 20(9): 1297-1303.
[29]	Meng L, Li H H, Zhang L Y, Wang J K.2015. QTL IciMapping: Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations.Crop J, 3: 269-283.
[30]	Min S, Lee S W, Choi B R, Lee S H, Kwon D H.2014. Insecticide resistance monitoring and correlation analysis to select appropriate insecticides againstNilaparvata lugens(Stål), a migratory pest in Korea. J Asia Pac Entomol, 17(4): 711-716.
[31]	Naik S B, Divya D, Sahu N, Sundaram R M, Sarao P S, Singh K, Lakshmi V J, Bentur J S.2018. A new gene Bph33(t) conferring resistance to brown planthopper (BPH), Nilaparvata lugens (Stål) in rice line RP2068-18-3-5. Euphytica, 214: 53.
[32]	Nemoto H, Ikeda R, Kaneda C.1989. New gene for resistance to brown planthopper,Nilaparvata lugens Stål, in rice. Jpn J Breeding, 39: 23-28.
[33]	Prahalada G D, Shivakumar N, Lohithaswa H C, Sidde Gowda D K, Ramkumar G, Kim S R, Ramachandra C, Hittalmani S, Mohapatra T, Jena K K.2017. Identification and fine mapping of a new gene,BPH31 conferring resistance to brown planthopper biotype 4 of India to improve rice, Oryza sativa L. Rice, 10: 41.
[34]	Qi L, Ding Y B, Zheng X M, Xu R, Zhang L Z, Wang Y Y, Wang X N, Zhang L F, Cheng Y L, Qiao W H, Yang Q W.2018. Fine mapping and identification of a novel locusqGL12.2 control grain length in wild rice(Oryza rufipogon Griff.). Theor Appl Genet, 131(7): 1497-1508.
[35]	Rahman M L, Jiang W Z, Chu S H, Qiao Y L, Ham T H, Woo M O, Lee J, Khanam M S, Chin J H, Jeung J U, Brar D S, Jena K K, Koh H J.2009. High-resolution mapping of two rice brown planthopper resistance genes,High-resolution mapping of two rice brown planthopper resistance genes, Bph20(t) and Bph21(t) originating from Oryza minuta. Theor Appl Genet, 119(7): 1237-1246.
[36]	Ram T, Deen R, Gautam S K, Ramesh K, Rao Y K, Brar D S.2010. Identification of new genes for brown planthopper resistance in rice introgressed fromO. glaberrima and O. minuta. Rice Genet Newsl, 25: 67-69.
[37]	Ren J S, Gao F Y, Wu X T, Lu X J, Zeng L H, Lv J Q, Su X W, Luo H, Ren G J.2016. Bph32, a novel gene encoding an unknown SCR domain-containing protein, confers resistance against the brown planthopper in rice. Sci Rep, 6: 37645.
[38]	Renganayaki K, Fritz A K, Sadasivam S, Pammi S, Harrington S E, McCouch S R, Kumar S M, Reddy A S.2002. Mapping and progress toward map-based cloning of brown planthopper biotype-4 resistance gene introgressed fromOryz officinalis into cultivated rice, O. sativa. Crop Sci, 42: 2112-2117.
[39]	Sarao P S, Sahi G K, Neelam K, Mangat G S, Patra B C, Singh K.2016. Donors for resistance to brown planthopper Nilaparvata lugens(Stål) from wild rice species. Rice Sci, 23(4): 219-224.
[40]	Shen Y J, Jiang H, Jin J P, Zhang Z B, Xi B, He Y Y, Wang G, Wang C, Qian L, Li X, Yu Q B, Liu H J, Chen D H, Gao J H, Huang H, Shi T L, Yang Z N.2004. Development of genome- wide DNA polymorphism database for map-based cloning of rice genes.Plant Physiol, 135(3): 1198-1205.
[41]	Sun J, Yang L M, Wang J G, Liu H L, Zheng H L, Xie D W, Zhang M H, Feng M F, Jia Y, Zhao H W, Zou D T.2018. Identification of a cold-tolerant locus in rice (Oryza sativa L.) using bulked segregant analysis with a next-generation sequencing strategy. Rice, 11: 24.
[42]	Takagi H, Abe A, Yoshida K, Kosugi S, Natsume S, Mitsuoka C, Uemura A, Utsushi H, Tamiru M, Takuno S, Innan H, Cano L M, Kamoun S, Terauchi R.2013. QTL-seq: Rapid mapping of quantitative trait loci in rice by whole genome resequencing of DNA from two bulked populations.Plant J, 74(1): 174-183.
[43]	Tamura Y, Hattori M, Yoshioka H, Yoshioka M, Takahashi A, Wu J Z, Sentoku N, Yasui H.2014. Map-based cloning and characterization of a brown planthopper resistance geneBPH26 from Oryza sativa L. ssp. indica cultivar ADR52. Sci Rep, 4: 5872.
[44]	Tanaka K, Endo S, Kazano H.2000. Toxicity of insecticides to predators of rice planthoppers: Spiders, the mired bug and the dryinid wasp.Appl Entomol Zool, 35: 177-187.
[45]	Wang H Y, Shi S J, Guo Q, Nie L Y, Du B, Chen R Z, Zhu L L, He G C.2018. High-resolution mapping of a gene conferring strong antibiosis to brown planthopper and developing resistant near-isogenic lines in 9311 background.Mol Breeding, 38: 107.
[46]	Wang K, Li M Y, Hakonarson H.2010. ANNOVAR: Functional annotation of genetic variants from high-throughput sequencing data.Nucl Acids Res, 38: e164.
[47]	Wang Y, Cao L M, Zhang Y X, Cao C X, Liu F, Huang F K, Qiu Y F, Li R B, Lou X J.2015. Map-based cloning and characterization ofBPH29, a B3 domain-containing recessive gene conferring brown planthopper resistance in rice. J Exp Bot, 66(19): 6035-6045.
[48]	Xiao C, Hu J, Ao Y T, Cheng M X, Gao G J, Zhang Q L, He G C, He Y Q.2016. Development and evaluation of near-isogenic lines for brown planthopper resistance in rice cv. 9311.Sci Rep, 6: 38159.
[49]	Yang H Y, Ren X, Weng Q M, Zhu L L, He G C.2002. Molecular mapping and genetic analysis of a rice brown planthopper (Nilarparvata lugens Stål) resistance gene. Hereditas, 136: 39-43.
[50]	Yang L, Li R B, Li Y R, Huang F K, Chen Y Z, Huang S S, Huang L F, Liu C, Ma Z F, Huang D H, Jiang J J.2012. Genetic mapping of bph20(t) and bph21(t) loci conferring brown planthopper resistance to Nilaparvata lugens Stål in rice (Oryza sativa L.). Euphytica, 183: 161-171.
[51]	Zhao Y, Huang J, Wang Z Z, Jing S L, Wang Y, Ouyang Y D, Cai B D, Xin X F, Liu X, Zhang C X, Pan Y F, Ma R, Li Q F, Jiang W H, Zeng Y, Shangguan X X, Wang H Y, Du B, Zhu L L, Xu X, Feng Y Q, He S Y, Chen R Z, Zhang Q F, He G C.2016. Allelic diversity in an NLR geneBPH9 enables rice to combat planthopper variation. Proc Natl Acad Sci USA, 113: 12850-12855.
[52]	Zheng W J, Wang Y, Wang L L, Ma Z B, Zhao J M, Wang P, Zhang L X, Liu Z H, Lu X C.2016. Genetic mapping and molecular marker development forPi65(t), a novel broad-spectrum resistance gene to rice blast using next-generation sequencing. Theor Appl Genet, 129(5): 1035-1044.

Marker	Physical position (bp)	Forward primer	Reverse primer
PSM15	7 093 839-7 093 993	AAAGACTGGACATGAAGTCG	TCTTGCCATAAAAAGACCAC
PSM11	7 307 740-7 307 835	AGCAGCTTGTAGTCCAGGTA	TTAGGAGCGTTTGTAGGAAG
PSM19	6 481 834-6 481 973	CGTTTGAAGTTGAAGGATTC	TAGATAAAAATTGGCCGAAG
PSM16	5 290 425-5 290 710	AATCACCATTGGCTTTTATCCC	ACCGTGTGCTGGACGAGGA
PSM20	6 938 563-6 938 767	GCAGAGAATGGAAGTAAAGCA	CAATGGACCTCAGGAATGTG
PSM8	13 819 492-13 819 703	CCACTGGAACAACAAATCAAA	TGTCAACTATTCAGAAACCTACC
PSM23	15 890 765-15 891 107	AGATGTTTATCCTCTTGCGGG	ATACCACAAAGTGCGATGATTC

Marker	Physical position (bp)	Forward primer	Reverse primer
PSM15	7 093 839-7 093 993	AAAGACTGGACATGAAGTCG	TCTTGCCATAAAAAGACCAC
PSM11	7 307 740-7 307 835	AGCAGCTTGTAGTCCAGGTA	TTAGGAGCGTTTGTAGGAAG
PSM19	6 481 834-6 481 973	CGTTTGAAGTTGAAGGATTC	TAGATAAAAATTGGCCGAAG
PSM16	5 290 425-5 290 710	AATCACCATTGGCTTTTATCCC	ACCGTGTGCTGGACGAGGA
PSM20	6 938 563-6 938 767	GCAGAGAATGGAAGTAAAGCA	CAATGGACCTCAGGAATGTG
PSM8	13 819 492-13 819 703	CCACTGGAACAACAAATCAAA	TGTCAACTATTCAGAAACCTACC
PSM23	15 890 765-15 891 107	AGATGTTTATCCTCTTGCGGG	ATACCACAAAGTGCGATGATTC

Number	Gene	Putative function
1	Os04g0191400	Expressed protein
2	Os04g0191800	OsFBX118-F-box domain containing protein, expressed
3	Os04g0193200	Methyl-CpG binding domain containing protein, expressed
4	Os04g0193950	NB-ARC, leucine-rich repeat family protein, expressed
5	Os04g0194000	OsFBX120-F-box domain containing protein, expressed
6	Os04g0194400	Hypothetical protein
7	Os04g0194433	Hypothetical gene
8	Os04g0194500	Similar to ABC transporter-like protein
9	Os04g0194600	TCP family transcription factor, putative, expressed
10	Os04g0195000	WD domain, G-beta repeat domain containing protein, expressed
11	Os04g0195400	Transposon protein, putative, unclassified, expressed
12	Os04g0196200	O-methyltransferase, putative, expressed
13	Os04g0196600	Glycosyltransferase, putative, expressed
14	Os04g0196850	Similar to OSIGBa0132I10.3 protein
15	Os04g0197100	Retrotransposon protein, putative, unclassified, expressed
16	Os04g0197500	UDP-glucuronosyl/UDP-glucosyltransferase family protein
17	Os04g0201200	Pumilio-family RNA binding repeat containing protein, expressed
18	Os04g0201800	Amino acid transporter protein, putative, expressed

Number	Gene	Putative function
1	Os04g0191400	Expressed protein
2	Os04g0191800	OsFBX118-F-box domain containing protein, expressed
3	Os04g0193200	Methyl-CpG binding domain containing protein, expressed
4	Os04g0193950	NB-ARC, leucine-rich repeat family protein, expressed
5	Os04g0194000	OsFBX120-F-box domain containing protein, expressed
6	Os04g0194400	Hypothetical protein
7	Os04g0194433	Hypothetical gene
8	Os04g0194500	Similar to ABC transporter-like protein
9	Os04g0194600	TCP family transcription factor, putative, expressed
10	Os04g0195000	WD domain, G-beta repeat domain containing protein, expressed
11	Os04g0195400	Transposon protein, putative, unclassified, expressed
12	Os04g0196200	O-methyltransferase, putative, expressed
13	Os04g0196600	Glycosyltransferase, putative, expressed
14	Os04g0196850	Similar to OSIGBa0132I10.3 protein
15	Os04g0197100	Retrotransposon protein, putative, unclassified, expressed
16	Os04g0197500	UDP-glucuronosyl/UDP-glucosyltransferase family protein
17	Os04g0201200	Pumilio-family RNA binding repeat containing protein, expressed
18	Os04g0201800	Amino acid transporter protein, putative, expressed