Effects of Space Flight on Expression of Key Proteins in Rice Leaves

doi:10.1016/j.rsci.2019.12.011

Abstract

Abstract:

As a unique form of abiotic stress, the environmental conditions of outer space are expected to induce changes in plant genomes, proteomes and metabolic pathways. However, the effect of outer space conditions on the overall physiology of plants at the protein level has yet to be reported. To investigate the effects of outer space conditions on the growth- and development-related physiological processes and metabolic pathways of rice different stages, the seeds of rice variety DN423 were sent into orbit for 12.5 d aboard the SJ-10 Returning Satellite, and then the seedlings of both treated and control rice were compared at the three-leaf stage (TLS) and tillering stage (TS). In addition to comparing plant growth and reactive oxygen species (ROS) levels, seedling proteomes were also compared using isobaric tags for relative and absolute quantitation (iTRAQ). Space flight increased TLS plant height by 20%, reduced and increased ROS levels of the TLS and TS seedlings, respectively, and affected the expression of 36 and 323 proteins in TLS and TS leaves, respectively. Furthermore, the functions of the differentially abundant proteins were mainly associated with metabolism, energy, and protein synthesis and degradation. These results suggested that the exposure of seeds to outer space conditions affects the subsequent abundance of key signaling proteins, gene expression, and the processes of protein synthesis and degradation, thereby affecting metabolic processes and promoting adaptation to the abiotic stress of outer space. As such, the present study sheds light on the effects of space flight on plants and contributes to a more comprehensive understanding of extraterrestrial biology.

Key words: differentially abundant protein, rice, proteomics, space flight

Deyong Zeng, Jie Cui, Yishu Yin, Meng Zhang, Shan Shan, Xin Gao, Yingchun Zhang, Yeqing Sun, Weihong Lu. Effects of Space Flight on Expression of Key Proteins in Rice Leaves[J]. Rice Science, 2020, 27(5): 423-433.

Figures/Tables 17

Supplemental Table 1 Primers used in the qRT-PCR analysis.

Gene	Forward primer (5’-3’)	Reverse primer (5’-3’)
RMa 1	CACGGACGACTCGGACTCTCAG	AGGTGTCAGCCTGGCTCTCAAG
EPB1	GGCGACATGGTGATGATGGACAG	TCGGCGAGCTGGTAAGTGAGG
SII-3	ACCTGCCTCACGGAACGGATC	GCTGCGGCTTGTCTACGGATG
Mtases	TAGCCTTGGCGAGAGCTGAT	TGGCCAACAATGGATCGCAG

Fig. 1. Relative plant height(A), total protein content (B), and reactive oxygen species (ROS) level (C) in treatment and control rice plants.TLS, Three-leaf stage; TS, Tillering stage.Data are presented as Mean ± SD (n = 30 for A, n = 3 for B and C). ** indicates significant difference at the 0.01 level by the t-test.

Supplemental Fig 1. Growth of rice at the three-leaf stage.

Fig. 2. Number of up-regulated and down- regulated differentially abundant proteins (DAPs) at the two different growth stages (A) and overlaps of the DAPs by Venn diagram (B).TLS-up, Up-regulated proteins at the three- leaf stage (TLS); TLS-down, Down-regulated proteins at the TLS; TS-up, Up-regulated proteins at the tillering stage (TS); TS-down, Down- regulated proteins at the TS.

Fig. 3. Gene ontology enrichment analysis of proteins with differential abundance at the three-leaf (A) and tillering (B) stages.

Fig. 4. Metabolic analysis of KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway (matched number more than two) at the three-leaf (A) and tillering (B) stages.

Fig. 5. KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment at the three-leaf stage (TLS) and tillering stage (TS).* and ** indicate the significant differences at the 0.05 and 0.01 levels by the Tukey’s test, respectively.

Supplemental Fig. 2. STRING analysis of 36 and 324 differentially expressed proteins following different growth periods after spaceflight, visualizing the presence of three five clusters.A, Three-leaf stage; B, Tillering stages.Red, metabolism; Green, protein synthesis; Blue Protein processing in the endoplasmic reticulum; Yellow, Glycolysis/Gluconeogenesis; Purple, Oxidative phosphorylation. Labels report protein Gene Names.

Fig. 6. Functional classification of differentially expressed proteins in leaves at the three-leaf (A) and tillering (B) stages.

Fig. 7. Comparison between protein abundance and mRNA level.P, Protein; G, Gene; TLS, Three-leaf stage; TS, Tillering stage; CK, Control; SP, Space.Data are represented as Mean ± SE (n = 3). ** indicates significant difference at the 0.01 level by the Tukey’s test.

Supplemental Fig. 3. The mechanism of rice response to space environment during different growth and development stages of rice seeds after 12.5 d of space flight.A represents the three-leaf stage; B represents the tilling stage. The increases and decrease are represented in red and green.

Supplemental Table 2 Changes in protein abundance associated with signal transduction in the three-leaf stage (TLS) and the tillering stage (TS) as identified by iTRAQ.

Supplemental Table 3 Changes in protein abundance associated with related to oxidative and stress responses in the three-leaf stage (TLS) and the tillering stage (TS) as identified by iTRAQ.

Supplemental Table 4 Changes in protein abundance associated with energy metabolism in the three-leaf stage (TLS) and the tillering stage (TS) as identified by iTRAQ.

Supplemental Table 5 Changes in protein abundance associated with gene expression regulatory in the three-leaf stage (TLS) and the tillering stage (TS) as identified by iTRAQ.

Supplemental Table 6 Changes in protein abundance associated with protein synthesis and processing in the three-leaf stage (TLS) and the tillering stage (TS) as identified by iTRAQ.

Supplemental Fig. 4. Formation process of eukaryotic translation initiation complex.Red represents the protein, green represents the down-regulated protein, and blue represents the undetected protein.

References 52

[1]	Barman A R, Banerjee J.2015. Versatility of germin-like proteins in their sequences, expressions, and functions. Funct Integr Genom, 15(5): 533-548.
[2]	Basile G, di Bello C, Taniuchi H.1980. Formation of an iso-1- cytochrome c-like species containing a covalently bonded heme group from the apoprotein by a yeast cell-free system in the presence of hemin. J Biol Chem, 255(15): 7181-7191.
[3]	Cui J, Xia W Y, Zhang M, Wang W, Sun Y Q, Lu W H.2019. Photosynthetic performance of rice seedlings originated from seeds exposed to spaceflight conditions. Photochem Photobiol, 95(5): 1205-1212.
[4]	Dievart A, Perin C, Hirsch J, Bettembourg M, Lanau N, Artus F, Bureau C, Noel N, Droc G, Peyramard M, Pereira S, Courtois B, Morel J B, Guiderdoni E.2016. The phenome analysis of mutant alleles in leucine-rich repeat receptor-like kinase genes in rice reveals new potential targets for stress tolerant cereals. Plant Sci, 242: 240-249.
[5]	Durante M.2002. Biological effects of cosmic radiation in low-earth orbit. Int J Mod Phys A, 17(12/13): 1713-1721.
[6]	Foreman J, Demidchik V, Bothwell J H F, Mylona P, Miedema H, Torres M A, Linstead P, Costa S, Brownlee C, Jones J D G, Davies J M, Dolan L.2003. Reactive oxygen species produced by NADPH oxidase regulate plant cell growth. Nature, 422: 442-446.
[7]	Gharechahi J, Hajirezaei M R, Salekdeh G H.2015. Comparative proteomic analysis of tobacco expressing cyanobacterial flavodoxin and its wild type under drought stress. J Plant Physiol, 175: 48-58.
[8]	Gong P J, Zhang J H, Li H X, Yang C X, Zhang C J, Zhang X H, Khurram Z, Zhang Y Y, Wang T T, Fei Z J, Ye Z B.2010. Transcriptional profiles of drought-responsive genes in modulating transcription signal transduction, and biochemical pathways in tomato. J Exp Bot, 61(13): 3563-3575.
[9]	Gowda N K C, Kandasamy G, Froehlich M S, Dohmen R J, Andreasson C.2013. Hsp70 nucleotide exchange factor Fes1 is essential for ubiquitin-dependent degradation of misfolded cytosolic proteins. Proc Natl Agric Sci USA, 110(15): 5975-5980.
[10]	Halperin T, Zheng B, Itzhaki H, Clarke A K, Adam Z.2001. Plant mitochondria contain proteolytic and regulatory subunits of the ATP-dependent Clp protease. Plant Mol Biology, 45(4): 461-468.
[11]	He Y T, Guo X, Yu Z H, Wu L, Gunawan A M, Zhang Y, Dixon J E, Zhang Z Y.2015. A potent and selective inhibitor for the UBLCP1 proteasome phosphatase. Bioorg Med Chem, 23(12): 2798-2809.
[12]	Hildenbeutel M, Hegg E L, Stephan K, Gruschke S, Meunier B, Ott M.2014. Assembly factors monitor sequential hemylation of cytochrome b to regulate mitochondrial translation. J Cell Biol, 205(4): 511-524.
[13]	Hüttner S, Veit C, Schoberer J, Grass J, Strasser R.2012. Unraveling the function of Arabidopsis thaliana OS9 in the endoplasmic reticulum-associated degradation of glycoproteins. Plant Mol Biol, 79(1): 21-33.
[14]	Hwang S G, Kim J J, Lim S D, Park Y C, Moon J C, Jang C S.2016. Molecular dissection of Oryza sativa salt-induced RING finger protein 1 (OsSIRP1): Possible involvement in the sensitivity response to salinity stress. Physiol Plant, 158(2): 168-179.
[15]	Isshiki M, Tsumoto A, Shimamoto K.2006. The serine/arginine rich protein family in rice plays important roles in constitutive and alternative splicing of pre-mRNA. Plant Cell, 18(1): 146-158.
[16]	Korb H, Neupert W.1978. Biogenesis of cytochrome c in Neurospora crassa: Synthesis of apocytochrome c, transfer to mitochondria and conversion to holocytochrome c. Eur J Biochem, 91(2): 609-620.
[17]	Kosova K, Vitamvas P, Prasil I T.2014. Proteomics of stress responses in wheat and barley-search for potential protein markers of stress tolerance. Front Plant Sci, 5: 711.
[18]	Kralj J G, Munson M S, Ross D.2014. Total protein quantitation using the bicinchoninic acid assay and gradient elution moving boundary electrophoresis. Electrophoresis, 35: 1887-1892.
[19]	Kwon T, Sparks J A, Nakashima J, Allen S N, Tang Y H, Blancaflor E B.2015. Transcriptional response of Arabidopsis seedlings during sapaceflight reveals peroxidase and cell wall remodeling genes associated with root hair development. Am J Bot, 102(1): 21-35.
[20]	Lin Z J D, Liebrand T W H, Yadeta K A, Coaker G.2015. PBL13 is a serine/threonine protein kinase that negatively regulates Arabidopsis immune responses. Plant Physiol, 169(4): 2950-2962.
[21]	Liu Y D, Li J M.2014. Endoplasmic reticulum-mediated protein quality control in Arabidopsis. Front Plant Sci, 5: 162.
[22]	Loeffen J, Smeets R, Smeitink J, Triepels R, Sengers R, Trijbels F, van den Heuvel L.1999. The human NADH: Ubiquinone oxidoreductase NDUFS5 (15 kDa) subunit: cDNA cloning, chromosomal localization, tissue distribution and the absence of mutations in isolated complex I-deficient patients. J Inherit Metab Dis, 22(1): 19-28.
[23]	Mei M, Qiu Y, He Y, Bucker H, Yang C H.1994. Mutational effects of space flight on Zea mays seeds. Adv Space Res, 14(10): 33-39.
[24]	Mei M, Sun Y, Huang R, Yao J, Zhang Q, Hong M, Ye J.1998. Morphological and molecular changes of maize plants after seeds been flown on recoverable satellite. Adv Space Res, 22: 1691-1697.
[25]	Millar A H, Whelan J, Soole K L, Day D A.2011. Organization and regulation of mitochondrial respiration in plants. Annu Rev Plant Biol, 62: 79-104.
[26]	Mittler R.2017. ROS are good. Trends Plant Sci, 22(1): 11-19.
[27]	Palusa S G, Ali G S, Reddy A S N.2007. Alternative splicing of pre-mRNAs of Arabidopsis serine/arginine-rich proteins: Regulation by hormones and stresses. Plant J, 49(6): 1091-1107.
[28]	Paul A L, Popp M P, Gurley W B, Guy C, Norwood K L, Ferl R J.2005. Arabidopsis gene expression patterns are altered during spaceflight. Adv Space Res, 36(7): 1175-1181.
[29]	Phillips J D, Graham L A, Trumpower B L.1993. Subunit 9 of the Saccharomyces cerevisiae cytochrome bc1 complex is required for insertion of EPR-detectable iron-sulfur cluster into the rieske iron-sulfur protein. J Biol Chem, 268(16): 11727-11736.
[30]	Rius S P, Casati P, Iglesias A A, Gomez-Casati D F.2008. Characterization of Arabidopsis lines deficient in GAPC-1, a cytosolic NAD-dependent glyceraldehyde-3-phosphate dehydrogenase. Plant Physiol, 148(3): 1655-1667.
[31]	Roomi S, Masi A, Conselvan G B, Trevisan S, Quaggiotti S, Pivato M, Arrigoni G, Yasmin T, Carletti P.2018. Protein profiling of Arabidopsis roots treated with humic substances: Insights into the metabolic and interactome networks. Front Plant Sci, 9: 1812.
[32]	Royo B, Esteban R, Buezo J, Santamaria E, Fernandez-Irigoyen J, Becker D, Moran J F.2019. The proteome of Medicago truncatula in response to ammonium and urea nutrition reveals the role of membrane proteins and enzymes of root lignification. Environ Exp Bot, 162: 168-180.
[33]	Salmi M L, Roux S J.2008. Gene expression changes induced by space flight in single-cells of the fern Ceratopteris richardii. Planta, 229(1): 151-159.
[34]	Saucedo A L, Hernández-Domínguez E E, de Luna-Valdez L A, Guevara-García A A, Escobedo-Moratilla A, Bojorquéz-Velázquez E, del Río-Portilla F, Fernández-Velasco D A, de la Rosa-Ana PB.2017. Insights on structure and function of a late embryogenesis abundant protein from Amaranthus cruentus: An intrinsically disordered protein involved in protection against desiccation, oxidant conditions, and osmotic stress. Front Plant Sci, 8: 497.
[35]	Shi S J, Li S G, Asim M, Mao J J, Xu D Z, Ullah Z, Liu G S, Wang Q, Liu H B.2018. The Arabidopsis calcium-dependent protein kinases (CDPKs) and their roles in plant growth regulation and abiotic stress responses. Int J Mol Sci, 19(7): 1900.
[36]	Sitia R, Braakman I.2003. Quality control in the endoplasmic reticulum protein factory. Nature, 426: 891-894.
[37]	Sugimoto M, Oono Y, Kawahara Y, Gusev O, Maekawa M, Matsumoto T, Levinskikh M, Sychev V, Novikova N, Grigoriev A.2016. Gene expression of rice seeds surviving 13- and 20-month exposure to space environment. Life Sci Space Res, 11: 10-17.
[38]	Takagi D, Ifuku K, Ikeda K I, Inoue K I, Park P, Tamoi M, Inoue H, Sakamoto K, Saito R, Miyake C.2016. Suppression of chloroplastic alkenal/one oxidoreductase represses the carbon catabolic pathway in Arabidopsis leaves during night. Plant Physiol, 170(4): 2024-2039.
[39]	Torii K U.2004. Leucine-rich repeat receptor kinases in plants: Structure, function, and signal transduction pathways. Int Rev Cytol, 234: 1-46.
[40]	Verchot J.2016. Plant virus infection and the ubiquitin proteasome machinery: Arms race along the endoplasmic reticulum. Viruses, 8(11): 314.
[41]	Wang J R, Yan Z H, Zheng Y L, Cao W G, Wei Y M.2010. Molecular cloning and phylogenetic analysis of fructosebisphosphate aldolase (cytoplasmic isozyme) in wheat, barley and rye. Cereal Res Commun, 38(4): 489-496.
[42]	Watanabe N, Lam E.2009. Bax inhibitor-1, a conserved cell death suppressor, is a key molecular switch downstream from a variety of biotic and abiotic stress signals in plants. Int J Mol Sci, 10(7): 3149-3167.
[43]	Wei L J, Yang Q, Xia H M, Furusawa Y, Guan S H, Xin P, Sun Y Q.2006. Analysis of cytogenetic damage in rice seeds induced by energetic heavy ions on-ground and after spaceflight. J Radiat Res, 47(3/4): 273-278.
[44]	Wisniewski J R, Zougman A, Nagaraj N, Mann M.2009. Universal sample preparation method for proteome analysis. Nat Methods, 6(5): 359-362.
[45]	Wong Y C, Teh H F, Mebus K, Ooi T E K, Kwong Q B, Koo K L, Ong C K, Mayes S, Chew F T, Appleton D R, Kulaveerasingam H.2017. Differential gene expression at different stages of mesocarp development in high- and low-yielding oil palm. BMC Genom, 18(1): 470.
[46]	Xu J, Yan T, Zhao Q, Shen Q G, Liu C D.1997. The effects of space circumstance on tropism growth and metabolic processes of asparagus seedlings. Acta Bioph Sinica, 13(4): 660-664.
[47]	Yang Y, Ma L, Zeng H, Chen L Y, Zheng Y, Li C X, Yang Z P, Wu N, Mu X, Dai C Y, Guan H L, Cui X M, Li Y.2018. iTRAQ- based proteomics screen for potential regulators of wheat (Triticum aestivum L.) root cell wall component response to Al stress. Gene, 675: 301-311.
[48]	Yu X, Wu H, Wei L J, Cheng Z L, Xin P, Huang C L, Zhang K P, Sun Y Q.2007. Characteristics of phenotype and genetic mutations in rice after spaceflight. Adv Space Res, 40(4): 528-534.
[49]	Zhang L, Du L Q, Shen C J, Yang Y J, Poovaiah B W.2014. Regulation of plant immunity through ubiquitin-mediated modulation of Ca2+- calmodulin-AtSR1/CAMTA3 signaling. Plant J, 78(2): 269-281.
[50]	Zhang Y, Wang L H, Xie J Y, Zheng H Q.2015. Differential protein expression profiling of Arabidopsis thaliana callus under microgravity on board the Chinese SZ-8 spacecraft. Planta, 241(2): 475-488.
[51]	Zhao Q, Zhou L J, Liu J C, Du X X, Asad M A U, Huang F D, Pan G, Cheng F M.2018. Relationship of ROS accumulation and superoxide dismutase isozymes in developing anther with floret fertility of rice under heat stress. Plant Physiol Biochem, 122: 90-101.
[52]	Zimmermann M W, Gartenbach K E, Kranz A R.1994. First radiobiogical results of LDEF-1 experiment A0015 with Arabidopsis seed embryos and Sordaria fungus spores. Adv Space Res, 14(10): 47-51.