Sugar Starvation Enhances Leaf Senescence and Genes Involved in Sugar Signaling Pathways Regulate Early Leaf Senescence in Mutant Rice

doi:10.1016/j.rsci.2019.11.001

Abstract

Abstract:

To clarify the complex regulatory relationship between changes in sugar content and leaf senescence during the grain-filling stage of rice, genotype-dependent differences in sugar content and the temporal transcriptional patterns of genes involved in sugar signaling pathways were determined in mutant rice exhibiting early leaf senescence and its wild type Zhefu 142. The effects of exogenous glucose or sucrose on the senescence of detached leaves under dark conditions were also investigated. Chlorophyll, soluble sugar, sucrose and fructose contents decreased, whereas electrolytic leakage and malondialdehyde levels increased in mutant leaves at the grain-filling stage. These results suggested that sugar starvation is positively correlated with the early leaf senescence of mutant plants. Detached leaf segments incubated in exogenous sugar solutions under dark conditions exhibited delayed senescence. The high expression of Hxk1 in leaves of mutant plants at the initial grain-filling stage suggested that Hxk1 is involved in the hexose-sensing process at the early stage of leaf senescence. The low expression levels of Hxk2 and Frk1 in the senescing leaves of mutant rice during the grain-filling stage are indicative of weakened hexose phosphorylation. In addition, the high expression levels of SuSy1, SuSy2 and SuSy4 in leaves of mutant plants at the initial grain-filling stage are accompanied by the high transcript levels of SUT1, which favor sucrose translocation and remobilization from the early senescing leaves of mutant rice. The relatively reduced transcript levels of chFBP, cyFBP, SPS1, SPS2 and SPS6 indicated that during the grain-filling stage, sucrose biosynthesis is weakened in the senescing leaves of mutant rice.

Key words: rice, sugar starvation, leaf senescence, signaling pathway, detached leaf segment, grain-filling stage

Zhaowei Li, Qian Zhao, Fangmin Cheng. Sugar Starvation Enhances Leaf Senescence and Genes Involved in Sugar Signaling Pathways Regulate Early Leaf Senescence in Mutant Rice[J]. Rice Science, 2020, 27(3): 201-214.

Figures/Tables 9

Supplemental Table 1. Primers used in quantitative real-time PCR.

Gene name	Accession No.	Forward primer (5′-3′)	Reverse primer (5′-3′)
Actin-1	X16280	CAGCACATTCCAGCAGATGT	TAGGCCGGTTGAAAACTTTG
Hxk1	AF372831	GGGGTTGTTTTATGCATTGG	CTTCTGGGAGGTGGAAATCA
Hxk2	AF372832	GCAAGTCTCGATCCCAAGAG	CTTTCCCAGCAGTTCCAGAG
Frk1	AF429948	TGATGCGTTTGTTGGTGCTCT	CTTTCTTTGTGGCGGTGATTG
Frk2	AF429947	CATCAGCAAGGCAGCCAACT	CGAAGCAGCAACTAAATTAAATCG
CIN1	AY342319	TACACGGTGGGCATCTACAA	TCCAGCCATACCTTTCTTGG
CIN4	AY578161	CATGTTTGTGCCGGATACTG	TGCCATCACCATCTAACCAA
SuSy1	AK100334	TGACTGGTCTGGTTGAGCTG	ACAAAAGCACCCTTGGTGTC
SuSy2	AK072074	TCCTGGAGCTGACATGAGTG	AAGACGAGCCATGGAGAAGA
SuSy4	AK102158	AGCCAATGTGTTGGGCTTAC	GCATGATGTCCCTTTTGCTT
SUT1	D87819	GCCAAGGAAGTTCCATTCAA	TGAGGATCAGTTCCCTTTGG
SUT4	AB091673	GCATGCTGGCTACAGCAATA	AGCAGTCAGCTCAGCAGTCA
chFBP	AK062233	TACGGCGAGTTCGTGCTGA	GGCTCCTTGAGGCTGTCCAT
cyFBP	AB007193	CAGTGAATGAAGGGAATGCGA	CATTTGGGCTCTTCTTGTCTGC
SPS1	NM_001051745	GAGACTTCGGAGGACCTTGCA	TGGGAGTGTCTTGCTGTGCC
SPS2	NM_001052643	TGATAATGGGTAACCGTGAGGC	CAGAGTGCTTATGATGCTTGGGAT
SPS6	NM_001064716	CGTGGTAGAAAGAAGAGGGAGGA	CAGAGCGTGACAACGGAGTGA
SPS8	NM_001068030	GGAGATTCCTTGAGGGATGTTC	CCATTTATTGCCTGTGGTAGCC

Fig. 1. Genotypic-dependent differences in total chlorophyll content (A), electrolytic leakage (B) and malondialdehyde (MDA) content (C) in flag leaves of wild type and mutant genotypes during grain-filling stage. Vertical bars represent standard errors (n = 3). Asterisks represent significant differences between the mutant and the wild type at the 0.05 level.

Fig. 2. Genotypic-dependent differences in soluble sugar (A), sucrose (B), glucose (C) and fructose (D) contents in flag leaves of wild type and mutant genotypes during grain-filling stage. Vertical bars represent standard errors (n = 3). Asterisks represent significant differences between the mutant and the wild type at the 0.05 level.

Fig. 3. Temporal analyses of the darkness-induced senescence of detached leaf segments incubated in 175 mmol/L glucose and sucrose, mannitol (osmosis control), hoagland nutrient solutions (control), and a gradient series of sucrose solutions for 6 d. A, Morphological changes exhibited by detached leaf segments after 0, 2, 4 and 6 d of incubation. B, Chlorophyll contents of detached leaf segments after 6 d of incubation in glucose, sucrose, mannitol and control. C, Morphological changes exhibited by detached leaf segments incubated in 20, 40, 80, 160, 320, 480 and 600 mmol/L sucrose solutions. D, Chlorophyll contents of detached leaf segments incubated in 20, 40, 80, 160, 320, 480 and 600 mmol/L sucrose solutions. Vertical bars represent standard errors (n = 3). Values with the same lowercase letters are not significantly different between different sugar treatments at the 0.05 level.

Fig. 4. Genotype-specific differences in the expression patterns of Hxk1 (A), Hxk2 (B), Frk1 (C) and Frk2 (D) in flag leaves of wild type and mutant genotypes during grain-filling stage. Vertical bars represent standard errors (n = 3). Asterisks represent significant differences between the wild type and the mutant at the 0.05 level. Values with the same uppercase and lowercase letters are not significantly different among wild type and mutants at the 0.05 level, respectively.

Fig. 5. Temporal analyses of Hxk1 (A), Hxk2 (B), Frk1 (C) and Frk2 (D) in detached wild type leaf segments incubated in 175 mmol/L sucrose, glucose and mannitol (osmosis control), and transcriptional analyses of Hxk1 (E), Hxk2 (F), Frk1 (G) and Frk2 (H) in the detached wild type leaf segments incubated in a gradient series of sucrose concentrations. For temporal analyses, the leaf segments were collected after 3, 6 and 12 h incubation, respectively, and treatment with Hoagland nutrient solution was set as the control. For transcriptional analyses, the leaf segments were collected after 6 h incubation. Vertical bars represent standard errors (n = 3). Values with the same lowercase letters are not significantly different between different sugar treatments at the 0.05 level.

Fig. 6. Relative expression levels of CIN1 and CIN4 genes in the mutant and wild type leaves under different treatments.A and B, Genotypic-dependent differences in the expression patterns of CIN1 (A) and CIN4 (B) in the flag leaves of wild type and mutant genotypes during the grain-filling stage. Asterisks represent significant differences between the wild type and the mutant at the 0.05 level. Values with the same uppercase and lowercase letters are not significantly different among the wild type and the mutants at the 0.05 level, respectively. C and D, Temporal analyses of CIN1 (C) and CIN4 (D) in detached wild type leaf segments incubated in 175 mmol/L sucrose, glucose and mannitol (osmosis control). Leaf segments were collected after 3, 6 and 12 h incubation, respectively. Values with the same lowercase letters are not significantly different among different sugar treatments at the 0.05 level. E and F, Transcriptional analyses of CIN1 (E) and CIN4 (F) in the detached wild type leaf segments incubated in a gradient series of sucrose concentrations. Leaf segments were collected after 6 h incubation. Treatment with Hoagland nutrient solution was set as the control. Values with the same lowercase letters are not significantly different among different sugar concentration treatments at the 0.05 level.Vertical bars represent standard errors (n = 3).

Fig. 7. Relative expression levels of SuSy1, SuSy2 and SuSy4 genes in the mutant and wild type leaves under different treatments.A?C, Genotypic-dependent differences in the expression patterns of SuSy1 (A), SuSy2 (B) and SuSy4 (C) in the flag leaves of wild type and mutant genotypes during the grain-filling stage. Asterisks represent significant differences between the wild type and the mutant at the 0.05 level. Values with the same uppercase and lowercase letters are not significantly different among the wild type and the mutants at the 0.05 level, respectively. D?F, Temporal analyses of SuSy1 (D), SuSy2 (E) and SuSy4 (F) in detached wild type leaf segments incubated in 175 mmol/L sucrose, glucose and mannitol (osmosis control). Leaf segments were collected after 3, 6 and 12 h incubation, respectively. Values with the same lowercase letters are not significantly different among different sugar treatments at the 0.05 level. G?I, The transcriptional analyses of SuSy1 (G), SuSy2 (H) and SuSy4 (I) in the detached wild-type leaf segments incubated in a gradient series of sucrose concentrations. Leaf segments were collected after 6 h incubation. Treatment with Hoagland nutrient solution was set as the control. Values with the same lowercase letters are not significantly different among different sugar concentration treatments at the 0.05 level. Vertical bars represent standard errors (n = 3).

Fig. 8. Genotypic-dependent differences in the expression patterns of SUT1 (A) , SUT4 (B), chFBP (C), cyFBP (D), SPS1 (E), SPS2 (F), SPS6 (G) and SPS8 (H) in the flag leaves of wild type and mutant genotypes during the grain-filling stage.Vertical bars represent standard errors (n = 3). Asterisks represent significant differences between the wild type and the mutant at the 0.05 level. Values with the same uppercase and lowercase letters are not significantly different among wild type and mutants at the 0.05 level.

References 52

[1]	Aoki N, Hirose T, Scofield G N, Whitfeld P R, Furbank R T.2003. The sucrose transporter gene family in rice.Plant Cell Physiol, 44(3): 223-232.
[2]	Balibrea Lara M E, Gonzalez Garcia M C, Fatima T, Ehness R, Lee T K, Proels R, Tanner W, Roitsch T.2004. Extracellular invertase is an essential component of cytokinin-mediated delay of senescence.Plant Cell, 16(5): 1276-1287.
[3]	Biswal B, Pandey J K.2018. Loss of photosynthesis signals a metabolic reprogramming to sustain sugar homeostasis during senescence of green leaves: Role of cell wall hydrolases.Photosynthetica, 56(1): 404-410.
[4]	Brouquisse R, Gaudillere J P, Raymond P.1998. Induction of a carbon-starvation-related proteolysis in whole maize plants submitted to light/dark cycle and to extended darkness.Plant Physiol, 117(4): 1281-1291.
[5]	Daie J.1993. Cytosolic fructose-1,6-bisphosphatase: A key enzyme in the sucrose biosynthetic pathway.Photosynth Res, 38(1): 5-14.
[6]	Davies H V, Shepherd L V T, Burrell M M, Carrari F, Urbanczyk- Wochniak E, Leisse A, Hancock R D, Taylor M, Viola R, Ross H, McRae D, Willmitzer L, Fernie A R.2005. Modulation of fructokinase activity of potato (Solanum tuberosum) results in substantial shifts in tuber metabolism. Plant Cell Physiol, 46(7): 1103-1115.
[7]	Dian W M, Jiang H W, Chen Q S, Liu F Y, Wu P.2003. Cloning and characterization of the granule-bound starch synthase II gene in rice: Gene expression is regulated by the nitrogen level, sugar and circadian rhythm.Planta, 218(2): 261-268.
[8]	Distelfeld A, Avni R, Fischer A M.2014. Senescence, nutrient remobilization, and yield in wheat and barley.J Exp Bot, 65(14): 3783-3798.
[9]	Essmann J, Schmitz-Thom I, Schön H, Sonnewald S, Weis E, Scharte J.2008. RNA interference-mediated repression of cell wall invertase impairs defense in source leaves of tobacco.Plant Physiol, 147(3): 1288-1299.
[10]	Feller U, Fischer A.1994. Nitrogen metabolism in senescing leaves.Crit Rev Plant Sci, 13(3): 241-273.
[11]	Gibson S I.2005. Control of plant development and gene expression by sugar signaling.Curr Opin Plant Biol, 8(1): 93-102.
[12]	Granot D.2007. Role of tomato hexose kinases.Funct Plant Biol, 34: 567-570.
[13]	Hanson J, Smeekens S.2009. Sugar perception and signaling: An update.Curr Opin Plant Biol, 12(5): 562-567.
[14]	Hensel L L, Grbić V, Baumgarten D A, Bleecker A B.1993. Developmental and age-related processes that influence the longevity and senescence of photosynthetic tissues inArabidopsis. Plant Cell, 5(5): 553-564.
[15]	International Rice Genome Sequencing Project (IRGSP). 2005. The map-based sequence of the rice genome.Nature, 436: 793-800.
[16]	Jang J C, León P, Zhou L, Sheen J.1997. Hexokinase as a sugar sensor in higher plants.Plant Cell, 9(1): 5-19.
[17]	Jin Y, Ni D A, Ruan Y L.2009. Posttranslational elevation of cell wall invertase activity by silencing its inhibitor in tomato delays leaf senescence and increases seed weight and fruit hexose level.Plant Cell, 21(7): 2072-2089.
[18]	Jongebloed U, Szederkényi J, Hartig K, Schobert C, Komor E.2004. Sequence of morphological and physiological events during natural ageing of a castor bean leaf: Sieve tube occlusions and carbohydrate back-up precede chlorophyll degradation.Physiol Plant, 120(2): 338-346.
[19]	Koch K.2004. Sucrose metabolism: Regulatory mechanisms and pivotal roles in sugar sensing and plant development.Curr Opin Plant Biol, 7(3): 235-246.
[20]	Lam E, Kato N, Lawton M.2001. Programmed cell death, mitochondria and the plant hypersensitive response.Nature, 411: 848-853.
[21]	Li Z W, Wang F B, Lei B T, Cao Z Z, Pan G, Cheng F M.2014. Genotypic-dependent alteration in transcriptional expression of various CAT isoenzyme genes inesl mutant rice and its relation to H2O2-induced leaf senescence. Plant Growth Regul, 73(3): 237-248.
[22]	Li Z W, Wang F B, Lin W W, Zhao Q, Liu J C, Cheng F M.2017. Carbon reserve and remobilization in leaf sheaths during the grain-filling stage in response to leaf early senescence.Acta Physiol Plant, 39: 10.
[23]	Lichtenthaler H K.1987. Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes.Methods Enzymol, 148: 350-382.
[24]	Lim P O, Kim H J, Nam H G.2007. Leaf senescence.Annu Rev Plant Biol, 58: 115-136.
[25]	Lin W W, Guo X D, Pan X F, Li Z W.2018. Chlorophyll composition, chlorophyll fluorescence, and grain yield change inesl mutant rice. Int J Mol Sci, 19(10): 2945.
[26]	Lu S Y, Wang Z C, Niu Y J, Guo Z F, Huang B R.2008. Antioxidant responses of radiation-induced dwarf mutants of bermudagrass to drought stress.J Am Soc Hortic Sci, 133(3): 360-366.
[27]	Luo X L, Huang Q F.2011. Relationships between leaf and stem soluble sugar content and tuberous root starch accumulation in Cassava.J Agric Sci, 3(2): 64-72.
[28]	Ma L, Zhang D C, Miao Q S, Yang J, Xuan Y H, Hu Y B.2017. Essential role of sugar transporter OsSWEET11 during the early stage of rice grain filling.Plant Cell Physiol, 58(5): 863-873.
[29]	Masclaux C, Valadier M H, Brugiere N, Morot-Gaudry J F, Hirel B.2000. Characterization of the sink/source transition in tobacco (Nicotiana tabacum L.) shoots in relation to nitrogen management and leaf senescence. Planta, 211(4): 510-518.
[30]	Noh Y S, Amasino R M.1999. Identification of a promoter region responsible for the senescence-specific expression ofSAG12. Plant Mol Biol, 41(2): 181-194.
[31]	Noodén L D, Guiamét J J, John I.1997. Senescence mechanisms.Physiol Plant, 101(4): 746-753.
[32]	Parrott D, Yang L, Shama L, Fischer A M.2005. Senescence is accelerated, and several proteases are induced by carbon ‘feast’ conditions in barley (Hordeum vulgare L.) leaves. Planta, 222(6): 989-1000.
[33]	Pourtau N, Jennings R, Pelzer E, Pallas J, Wingler A.2006. Effect of sugar-induced senescence on gene expression and implications for the regulation of senescence inArabidopsis. Planta, 224(3): 556-568.
[34]	Quirino B F, Noh Y S, Himelblau E, Amasino R M.2000. Molecular aspects of leaf senescence.Trends Plant Sci, 5(7): 278-282.
[35]	Rolland F, Moore B, Sheen J.2002. Sugar sensing and signaling in plants.Plant Cell, 14: S185-S205.
[36]	Rose T L, Bonneau L, Der C, Marty-Mazars D, Marty F.2006. Starvation-induced expression of autophagy-related genes inArabidopsis. Biol Cell, 98(1): 53-67.
[37]	Saher S, Piqueras A, Hellin E, Olmos E.2004. Hyperhydricity in micropropagated carnation shoots: The role of oxidative stress.Physiol Plant, 120(1): 152-161.
[38]	Schmittgen T D, Livak K J.2008. Analyzing real-time PCR data by the comparative C(T) method.Nat Protoc, 3: 1101-1108.
[39]	Smeekens S, Ma J K, Hanson J, Rolland F.2010. Sugar signals and molecular networks controlling plant growth.Curr Opin Plant Biol, 13(3): 274-279.
[40]	Stein O, Granot D.2018. Plant fructokinases: Evolutionary, developmental, and metabolic aspects in sink tissues.Front Plant Sci, 9: 339.
[41]	Stein O, Secchi F, German M A, Damari-Weissler H, Aloni R, Holbrook N M, Zwieniecky M A, Granot D.2017. The tomato cytosolic fructokinaseFRK1 is important for phloem fiber development. Biol Plant, 62(2): 353-361.
[42]	Takahashi A, Kawasaki T, Wong H L, Suharsono U, Hirano H, Shimamoto K.2003. Hyperphosphorylation of a mitochondrial protein, prohibitin, is induced by calyculin A in a rice lesionmimic mutantcdr1. Plant Physiol, 132(4): 1861-1869.
[43]	Tang G Q, Luscher M, Sturm A.1999. Antisense repression and vacuolar and cell wall invertase in transgenic carrot alters early plant development and sucrose partitioning.Plant Cell, 11(2): 177-189.
[44]	van Doorn W G.2008. Is the onset of senescence in leaf cells of intact plants due to low or high sugar levels?J Exp Bot, 59(8): 1963-1972.
[45]	Wingler A, Purdy S, MacLean J A, Pourtau N.2006. The role of sugars in integrating environmental signals during the regulation of leaf senescence.J Exp Bot, 57(2): 391-399.
[46]	Wingler A, Roitsch T.2008. Metabolic regulation of leaf senescence: Interactions of sugar signaling with biotic and abiotic stress responses.Plant Biol, 10(S1): 50-62.
[47]	Woo H R, Kim H J, Nam H G, Lim P O.2013. Plant leaf senescence and death: Regulation by multiple layers of control and implications for aging in general.J Cell Sci, 126: 4823-4833.
[48]	Wu X Y, Kuai B K, Jia J Z, Jing H C.2012. Regulation of leaf senescence and crop genetic improvement.J Integr Plant Biol, 54(12): 936-952.
[49]	Xiao W, Sheen J, Jang J C.2000. The role of hexokinase in plant sugar signal transduction and growth and development.Plant Mol Biol, 44(4): 451-461.
[50]	Yang X, Gong P, Li K Y, Huang F D, Cheng F M, Pan G.2016. A single cytosine deletion in theOsPLS1 gene encoding vacuolar- type H+-ATPase subunit A1 leads to premature leaf senescence and seed dormancy in rice. J Exp Bot, 67(9): 2761-2776.
[51]	Yoshida S.2003. Molecular regulation of leaf senescence.Curr Opin Plant Biol, 6(1): 79-84.
[52]	Zhao H, Wang F B, Han Z Y, Shamsu-Ado Z, Li Z W, Pan G, Cheng F M.2018. Senescence-specific changes in endogenous IAA content and its conjugated status in rice flag leaf as affected by nitrogen level.Chin J Rice Sci, 32(6): 591-600. (in Chinese with English abstract)