Rice Heavy Metal P-type ATPase OsHMA6 Is Likely a Copper Efflux Protein

doi:10.1016/j.rsci.2020.01.005

Abstract

Abstract:

P_1B-type heavy metal ATPases (HMAs) are transmembrane metal-transporting proteins that play a key role in metal homeostasis. We here reported the characterization of rice OsHMA6, a member of the P_1B-type ATPase family. Phylogenetic tree analysis showed that OsHMA6 belonged to the Cu/Ag subgroup of the HMA family and had a close evolutionary relationship with OsHMA9. Amino acid sequence alignment showed 82.78% consistency between OsHMA6 and OsHMA9. OsHMA6 expressed in all organs at different growth stages, including spikelet, and abundant in leaf blades, however, OsHMA9 most strongly expressed in roots, but very low in spikelet. Excessive Cu²⁺ can up-regulate the expression of OsHMA6 and OsHMA9 in rice seedlings. The heterologous expression in yeast showed that OsHMA6 can significantly rescue the growth of yeast strain CM52 when supplied with 3 or 6 mmol/L Cu²⁺. Compared with the empty vector pYES2, the Cu concentration in OsHMA6-pYES2 decreased by 23.4% and 30.3% under 3 or 6 mmol/L Cu²⁺, respectively. Subcellular localization revealed that OsHMA6 was located in the plasma membrane. These results suggested that OsHMA6, similar to OsHMA9, is likely a copper efflux protein located in the plasma membrane.

Key words: OsHMA6, P_1B-type ATPase, copper, cadmium, efflux, rice, subcellular localization

Wenli Zou, Chang Li, Yajun Zhu, Jingguang Chen, Haohua He, Guoyou Ye. Rice Heavy Metal P-type ATPase OsHMA6 Is Likely a Copper Efflux Protein[J]. Rice Science, 2020, 27(2): 143-151.

Figures/Tables 10

Supplemental Table 1. Primers used for qRT-PCR.

Gene name	Forward primer (5′ to 3′)	Reverse primer (5′ to 3′)
OsActin	GGAACTGGTATGGTCAAGGC	AGTCTCATGGATAACCGCAG
OsHMA6	GGGACAGTCTTGAGCCAGAT	TCCGCAAAGAAACCATGCAA
OsHMA9	GTTGTCGGCAAACGGTTCTA	AACCCAGTGAATGCTCCGTA

Fig. 1. Phylogenic tree of HMA proteins of Arabidopsis and rice. The phylogenetic tree was constructed using the Neighbor-Joining method with 1000 bootstrap replicates in MEGA 7.0. Green indicates the Cu/Ag subgroup and pink indicates the Zn/Cd/Co/Pb subgroup. The amino sequences of rice and Arabidopsis HMA genes were downloaded from the Rice Genome Annotion Project (http://rice.plantbiology.msu.edu/annotation.shtml) and Tair (https://www.arabidopsis.org/).OsHMA1, LOC_Os06g47550; OsHMA2, LOC_ Os06g48720; OsHMA3, LOC_Os07g12900; OsHMA4, LOC_Os02g10290; OsHMA5, LOC_Os04g46940; OsHMA6, LOC_Os02g07630; OsHMA7, LOC_ Os08g37950; OsHMA8, LOC_Os03g08070; OsHMA9, LOC_Os06g45500.

Table 1 Percentage of amino acid sequence similarity among OsHMAs. %

OsHMA	OsHMA1	OsHMA2	OsHMA3	OsHMA4	OsHMA5	OsHMA6	OsHMA7	OsHMA8
OsHMA2	16.58							25.59
OsHMA3	18.4	45.88
OsHMA4	18.49	12.99	13.98
OsHMA5	17.19	10.37	13.82	53.14
OsHMA6	16.95	11.55	12.88	45.54	45.38
OsHMA7	20.04	12.63	19.23	28.88	28.69	27.34
OsHMA8	20.28	10.77	19.96	26	25.91	24.22	36.65
OsHMA9	17.68	10.35	12.57	44.97	45.56	82.78	26.61

Supplemental Fig. 1 OsHMA6 and OsHMA9 have similar intron-exon structures and protein transmembrane topology models.

Fig. 2. Expression levels of OsHMA6 and OsHMA9 in different organs at different growth stages. Samples were taken from rice cultivar Wuyunjing 7 grown in a paddy field. Rice OsActin (NM_197297) was used as a reference gene. Values are Mean ± SE (n = 3).

Fig. 3. Dose-responses of OsHMA6 and OsHMA9 expression. A and B, OsHAM6 and OsHMA9 expression in response to Cu2+, respectively. C and D, OsHMA6 and OsHMA9 expression in response to Cd2+, respectively. The rice cultivar Wuyunjing 7 seedlings at 14-day-old were treated for 3 d under nutrient solution with different concentrations of Cu2+ or Cd2+. RNA was extracted from rice roots. Rice OsActin (NM_197297) was used as a reference gene. Values are Mean ± SE (n = 3). The different letters above the bars indicate a significant difference between the control and treatments (P < 0.01).

Fig. 4. Transport activity of OsHMA6 in yeast.A and B, Overnight yeast cell suspension of CM52 transformed with empty vector pYES2 or OsHMA6-pYES2 were serially diluted (1:10) and spotted on the solid media containing 0, 3 and 6 mmol/L CuSO4 (A) or 0, 10 and 20 μmol/L CdCl2 (B). Pictures were taken after 3 d growth at 30 ºC.

Fig. 5. Functional assay of OsHMA6 by heterologous expression in yeast. A?D, Yeast strains were grown in liquid media without Cu2+ and Cd2+ (A), with 3 mmol/L CuSO4 (B), 6 mmol/L CuSO4 (C), or 20 μmol/L CdCl2 (D) for 30 h. The absorbance at 600 nm (OD600) of cell cultures was measured every 5 h. E and F, Effects of OsHMA6 expression on Cd (E) and Cu (F) accumulation in yeast cells. The dried strains in E and F were determined at 30 h treatment. Values are Mean ± SE (n = 3). Asterisks indicate significant differences between strains transformed with empty vector and strains expressing OsHMA6 (P < 0.01).

Fig. 6. Subcellular localization of OsHMA6 protein. The OsHMA6:GFP construct was transformed into Arabidopsis mesophyll protoplasts and detected by a laser scanning microscope (LSM410; Carl Zeiss, Germany). Scale bars = 10 μm.

Supplemental Fig. 2 Subcellular localization of OsHMA6:YFP in yeast cells.

References 41

[1]	Abdel-Ghany S E, Müller-Moulé P, Niyogi K K, Pilon M, Shikanai T. 2005. Two P-type ATPases are required for copper delivery in Arabidopsis thaliana chloroplasts. Plant Cell, 17(4): 1233-1251.
[2]	Alaoui-Sossé B, Genet P, Vinit-Dunand F, Toussaint M L, Epron D, Badot P M. 2004. Effect of copper on growth in cucumber plants (Cucumis sativus) and its relationships with carbohydrate accumulation and changes in ion contents. Plant Sci, 166(5): 1213-1218.
[3]	Andrés-Colás N, Sancenon V, Rodriguez-Navarro S, Mayo S, Thiele D J, Ecker J R, Puig S, Penarrubia L. 2006. The Arabidopsis heavy metal P-type ATPase HMA5 interacts with metallochaperones and functions in copper detoxification of roots. Plant J, 45(2): 225-236.
[4]	Andrés-Colás N, Perea-García A, Puig S, Peñarrubia L. 2010. Deregulated copper transport affects Arabidopsis development especially in the absence of environmental cycles. Plant Physiol, 153(1): 170-184.
[5]	Argüello J M, Eren E, González-Guerrero M. 2007. The structure and function of heavy metal transport P1B-ATPases. BioMetals, 20: 233-248.
[6]	Barberon M, Geldner N. 2014. Radial transport of nutrients: The plant root as a polarized epithelium. Plant Physiol, 166(2): 528-537.
[7]	Bernal M, Roncel M, Ortega J M, Picorel R, Yruela I. 2004. Copper effect on cytochrome b of photosystem II under photoinhibitory conditions. Physiol Plant, 120(4): 686-694.
[8]	Bernal M, Ramiro M V, Cases R, Picorel R, Yruela I. 2006. Excess copper effect on growth, chloroplast ultrastructure, oxygen- evolution activity and chlorophyll fluorescence in glycine max cell suspensions. Physiol Plant, 127(2): 312-325.
[9]	Burkhead J L, Reynolds K A, Abdel-Ghany S E, Cohu C M, Pilon M. 2009. Copper homeostasis. New Phytol, 182(4): 799-816.
[10]	Che J, Yamaji N, Ma J F. 2018. Efficient and flexible uptake system for mineral elements in plants. New Phytol, 219(2): 513-517.
[11]	Colangelo E P, Guerinot M L. 2006. Put the metal to the petal: Metal uptake and transport throughout plants. Curr Opin Plant Biol, 9(3): 322-330.
[12]	Collins J F, Klevay L M. 2011. Copper. Adv Nutr, 2(6): 520-522.
[13]	Deng F L, Yamaji N, Xia J X, Ma J F. 2013. A member of the heavy metal P-type ATPase OsHMA5 is involved in xylem loading of copper in rice. Plant Physiol, 163(3): 1353-1362.
[14]	Gulec S, Collins J F. 2014. Molecular mediators governing iron-copper interactions. Annu Rev Nutr, 34: 95-116.
[15]	Hansch R, Mendel R R. 2009. Physiological functions of mineral micronutrients (Cu, Zn, Mn, Fe, Ni, Mo, B, Cl). Curr Opin Plant Biol, 12(3): 259-266.
[16]	Huang X Y, Deng F L, Yamaji N, Pinson S R M, Fujii-Kashino M, Danku J, Douglas A, Guerinot M L, Salt D E, Ma J F. 2016. A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain. Nat Commun, 7: 12138.
[17]	Hussain D, Haydon M J, Wang Y W, Wong E, Sherson S M, Young J, Camakaris J, Harper J F, Cobbett C S. 2004. P-type ATPase heavy metal transporters with roles in essential zinc homeostasis in Arabidopsis. Plant Cell, 16(5): 1327-1339.
[18]	Jung H I, Gayomba S R, Rutzke M A, Craft E, Kochian L V, Vatamaniuk O K. 2012. COPT6 is a plasma membrane transporter that functions in copper homeostasis in Arabidopsis and is a novel target of SQUAMOSA promoter-binding protein- like 7. J Biol Chem, 287: 33252-33267.
[19]	Kampfenkel K, Kushnir S, Babiychuk E, Inze D, van Montagu M. 1995. Molecular characterization of a putative Arabidopsis thaliana copper transporter and its yeast homologue. J Biol Chem, 270: 28479-28486.
[20]	Klaumann S, Nickolaus S D, Furst S H, Starck S, Schneider S, Ekkehard Neuhaus H, Trentmann O. 2011. The tonoplast copper transporter COPT5 acts as an exporter and is required for interorgan allocation of copper in Arabidopsis thaliana. New Phytol, 192(2): 393-404.
[21]	Kobayashi Y, Kuroda K, Kimura K, Southron-Francis J L, Furuzawa A, Kimura K, Iuchi S, Kobayashi M, Taylor G J, Koyama H. 2008. Amino acid polymorphisms in strictly conserved domains of a P-type ATPase HMA5 are involved in the mechanism of copper tolerance variation in Arabidopsis. Plant Physiol, 148(2): 969-980.
[22]	Kong X Y, Liu T, Yu Z H, Chen Z, Lei D, Wang Z W, Zhang H, Li Q H, Zhang S S. 2018. Heavy metal bioaccumulation in rice from a high geological background area in Guizhou Province, China. Int J Environ Res Pub Health, 15(10): E2281.
[23]	Lee S, Kim Y Y, Lee Y, An G. 2007. Rice P1B-type heavy-metal ATPase, OsHMA9, is a metal efflux protein. Plant Physiol, 145(3): 831-842.
[24]	Lequeux H, Hermans C, Lutts S, Verbruggen N. 2010. Response to copper excess in Arabidopsis thaliana: Impact on the root system architecture, hormone distribution, lignin accumulation and mineral profile. Plant Physiol Biochem, 48(8): 673-682.
[25]	Li N N, Xiao H, Sun J J, Wang S F, Wang J C, Chang P, Zhou X B, Lei B, Lu K, Luo F, Shi X J, Li J N. 2018. Genome-wide analysis and expression profiling of the HMA gene family in Brassica napus under Cd stress. Plant Soil, 426: 365-381.
[26]	Li Y B, Iqbal M, Zhang Q Q, Spelt C, Bliek M, Hakvoort H W J, Quattrocchio F M, Koes R, Schat H. 2017. Two Silene vulgaris copper transporters residing in different cellular compartments confer copper hypertolerance by distinct mechanisms when expressed in Arabidopsis thaliana. New Phytol, 215(3): 1102-1114.
[27]	Ma J F, Ueno D, Zhao F J, McGrath S P. 2004. Subcellular localisation of Cd and Zn in the leaves of a Cd-hyper- accumulating ecotype of Thlaspi caerulescens. Planta, 220(5): 731-736.
[28]	Migocka M, Papierniak A, Maciaszczyk-Dziubinska E, Posyniak E, Kosieradzka A. 2015a. Molecular and biochemical properties of two P1B2-ATPases, CsHMA3 and CsHMA4, from cucumber. Plant Cell Environ, 38(6): 1127-1141.
[29]	Migocka M, Posyniak E, Maciaszczyk-Dziubinska E, Papierniak A, Kosieradzaka A. 2015b. Functional and biochemical characterization of cucumber genes encoding two copper ATPases CsHMA5.1 and CsHMA5.2. J Biol Chem, 290: 15717-15729.
[30]	Morel M, Crouzet J, Gravot A, Auroy P, Leonhardt N, Vavasseur A, Richaud P. 2009. AtHMA3, a P1B-ATPase allowing Cd/Zn/Co/Pb vacuolar storage in Arabidopsis. Plant Physiol, 149(2): 894-904.
[31]	Navari-Izzo F, Cestone B, Cavallini A, Natali L, Giordani T, Quartacci M F. 2006. Copper excess triggers phospholipase D activity in wheat roots. Phytochemistry, 67(12): 1232-1242.
[32]	Pilon M, Abdel-Ghany S E, Cohu C M, Gogolin K A, Ye H. 2006. Copper cofactor delivery in plant cells. Curr Opin Plant Biol, 9(3): 256-263.
[33]	Sancenón V, Puig S, Mira H, Thiele D J, Peñarrubia L. 2003. Identification of a copper transporter family in Arabidopsis thaliana. Plant Mol Biol, 51(4): 577-587.
[34]	Sancenón V, Puig S, Mateu-Andrés I, Dorcey E, Thiele D J, Peñarrubia L. 2004. The Arabidopsis copper transporter COPT1 functions in root elongation and pollen development. J Biol Chem, 279(15): 15348-15355.
[35]	Takahashi R, Bashir K, Ishimaru Y, Nishizawa N K, Nakanishi H. 2012. The role of heavy-metal ATPases, HMAs, in zinc and cadmium transport in rice. Plant Signal Behav, 7(12): 1605-1607.
[36]	Ueno D, Yamaji N, Ma J F. 2009. Further characterization of ferric-phytosiderophore transporters ZmYS1 and HvYS1 in maize and barley. J Exp Bot, 60(12): 3513-3520.
[37]	Waters B M, Chu H H, Didonato R J, Roberts L A, Eisley R B, Lahner B, Salt D E, Walker E L. 2006. Mutations in Arabidopsis yellow stripe-like1 and yellow stripe-like3 reveal their roles in metal ion homeostasis and loading of metal ions in seeds. Plant Physiol, 141(4): 1446-1458.
[38]	White P J, Broadley M R. 2009. Biofortification of crops with seven mineral elements often lacking in human diets: Iron, zinc, copper, calcium, magnesium, selenium and iodine. New Phytol, 182(1): 49-84.
[39]	Wintz H, Fox T, Wu Y Y, Feng V, Chen W Q, Chang H S, Zhu T, Vulpe C. 2003. Expression profiles of Arabidopsis thaliana in mineral deficiencies reveal novel transporters involved in metal homeostasis. J Biol Chem, 278: 47644-47653.
[40]	Yuan M, Li X H, Xiao J H, Wang S P. 2011. Molecular and functional analyses of COPT/Ctr-type copper transporter-like gene family in rice. BMC Plant Biol, 11: 69.
[41]	Zhang C, Lu W H, Yang Y, Shen Z G, Ma J F, Zheng L Q. 2018. OsYSL16 is required for preferential Cu distribution to floral organs in rice. Plant Cell Physiol, 59(10): 2039-2051.