
Rice Science ›› 2017, Vol. 24 ›› Issue (1): 41-47.DOI: 10.1016/j.rsci.2016.07.004
• Orginal Article • Previous Articles Next Articles
Yan Liang1, Bai-yuan Yan2, Yun-liang Peng3, Zhi-juan Ji1, Yu-xiang Zeng1, Han-lin Wu1, Chang-deng Yang1(
)
Received:2016-05-04
Accepted:2016-07-03
Online:2017-01-10
Published:2016-11-01
Yan Liang, Bai-yuan Yan, Yun-liang Peng, Zhi-juan Ji, Yu-xiang Zeng, Han-lin Wu, Chang-deng Yang. Molecular Screening of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae[J]. Rice Science, 2017, 24(1): 41-47.
Add to citation manager EndNote|Ris|BibTeX
| Gene | Chr | Marker | Forward (5′-3′) | Reverse (5′-3′) | AT (°C) | ES (bp) | Reference |
|---|---|---|---|---|---|---|---|
| Pi-d2 | 6 | ttggctatcataggcgtcc | atttgaaggcgtttgcgtaga | 55 | 1 057 | ||
| Pi-36 | 8 | caatgtgtgacttgtgcggact | tcttccatctcggatttcgtgt | 55 | 1 036 | ||
| Pi-37 | 1 | tcttgagggtcccagtgtac | cgaacagtggctggtatctc | 55 | 1 149 | ||
| Pi5 | 9 | tcctcctcttcggacacctc | cggacgagcgatagtgatcc | 55 | 594 | ||
| Pi-z | 6 | Z56592 | ggacccgcgttttccacgtgtaa | aggaatctattgctaagcatgac | 60 | 292 | |
| Piz-t | 6 | Zt56591 | ttgctgagccattgttaaaca | atctcttcatatatatgaaggccac | 60 | 257 | |
| Pik-p | 11 | K3957 | atagttgaatgtatggaatggaat | ctgcgccaagcaataaagtc | 60 | 148 | |
| Pik-h | 11 | Candi gene marker | catgagttccatttactattcctc | acattggtagtagtgcaatgtca | 55 | 1 500 | |
| Pi-b | 2 | Pb28 | gactcggtcgaccaattcgcc | atcaggccaggccagatttg | 60 | 388 | |
| Pi-9 | 6 | 195R-1 | atggtcctttatctttattg | ttgctccatctcctctgtt | 56 | 2 000 | |
| Pi-ta/Pi-ta2 | 12 | YL155/YL87 | agcaggttataagctaggcc | ctaccaacaagttcatcaaa | 55 | 1 042 | Jia et al (2002, 2004) |
| Chr, Chromosome; AT, Annealling temperature; ES, Expected size. | |||||||
Table 1 Details of single nucleotide polymorphisms and gene based sequence-tagged site markers tightly linked to the major rice blast resistant genes.
| Gene | Chr | Marker | Forward (5′-3′) | Reverse (5′-3′) | AT (°C) | ES (bp) | Reference |
|---|---|---|---|---|---|---|---|
| Pi-d2 | 6 | ttggctatcataggcgtcc | atttgaaggcgtttgcgtaga | 55 | 1 057 | ||
| Pi-36 | 8 | caatgtgtgacttgtgcggact | tcttccatctcggatttcgtgt | 55 | 1 036 | ||
| Pi-37 | 1 | tcttgagggtcccagtgtac | cgaacagtggctggtatctc | 55 | 1 149 | ||
| Pi5 | 9 | tcctcctcttcggacacctc | cggacgagcgatagtgatcc | 55 | 594 | ||
| Pi-z | 6 | Z56592 | ggacccgcgttttccacgtgtaa | aggaatctattgctaagcatgac | 60 | 292 | |
| Piz-t | 6 | Zt56591 | ttgctgagccattgttaaaca | atctcttcatatatatgaaggccac | 60 | 257 | |
| Pik-p | 11 | K3957 | atagttgaatgtatggaatggaat | ctgcgccaagcaataaagtc | 60 | 148 | |
| Pik-h | 11 | Candi gene marker | catgagttccatttactattcctc | acattggtagtagtgcaatgtca | 55 | 1 500 | |
| Pi-b | 2 | Pb28 | gactcggtcgaccaattcgcc | atcaggccaggccagatttg | 60 | 388 | |
| Pi-9 | 6 | 195R-1 | atggtcctttatctttattg | ttgctccatctcctctgtt | 56 | 2 000 | |
| Pi-ta/Pi-ta2 | 12 | YL155/YL87 | agcaggttataagctaggcc | ctaccaacaagttcatcaaa | 55 | 1 042 | Jia et al (2002, 2004) |
| Chr, Chromosome; AT, Annealling temperature; ES, Expected size. | |||||||
| Accession | Pi-d2 | Pi-z | Piz-t | Pi-9 | Pi-36 | Pi-37 | Pi5 | Pi-b | Pi-ta2 | Pik-p | Pik-h | Total genes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| IR31892-100-3-3-3 | 1a | 1 | 1 | 0a | 0 | 1 | 0 | 1 | 1 | 0 | 0 | 6 |
| M2-9-14UL | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 4 |
| C5216-B-3-1-1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
| Chang B8 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 6 |
| Chang A5 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 1 | 7 |
| Yuetai 13 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 7 |
| Huanglizhan | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 4 |
| Yebahuangzhan | 1 | 1 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 7 |
| Taiaosimiao | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 6 |
| Fengsizhan 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 1 | 6 |
| Baitaixiangzhan | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 5 |
| IR76479-48-1-3-1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 4 |
| IR72903-99-2-3-2 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 5 |
| Zhaitang | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 3 |
| Xuxiaoqu 10 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 6 |
| 062A1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 5 |
| N11 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 6 |
| A10 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 6 |
| C3 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 1 | 7 |
| Yunjing 136 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 5 |
| Zhongle 8610 | 1 | 1 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 6 |
| 41 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 6 |
| 43 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 5 |
| 488 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 1 | 6 |
| 6003 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 1 | 1 | 9 |
| 6004 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 6 |
| 6020 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 5 |
| 6021 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 5 |
| 6181 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 1 | 1 | 7 |
| 237-1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 1 | 1 | 7 |
| 237-2 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 1 | 1 | 9 |
| 1579 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 1 | 1 | 0 | 0 | 6 |
| R gene frequency (%) | 100.0 | 100.0 | 87.5 | 37.5 | 9.4 | 12.5 | 34.4 | 96.9 | 34.4 | 28.1 | 43.8 | |
| a, ‘1’ represents presence of amplicon and ‘0’ represents absence of amplicon. | ||||||||||||
Table 2 Single nucleotide polymorphisms and sequence-tagged site markers associated with eleven blast resistance genes in 32 rice germplasms.
| Accession | Pi-d2 | Pi-z | Piz-t | Pi-9 | Pi-36 | Pi-37 | Pi5 | Pi-b | Pi-ta2 | Pik-p | Pik-h | Total genes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| IR31892-100-3-3-3 | 1a | 1 | 1 | 0a | 0 | 1 | 0 | 1 | 1 | 0 | 0 | 6 |
| M2-9-14UL | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 4 |
| C5216-B-3-1-1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
| Chang B8 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 6 |
| Chang A5 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 1 | 7 |
| Yuetai 13 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 7 |
| Huanglizhan | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 4 |
| Yebahuangzhan | 1 | 1 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 7 |
| Taiaosimiao | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 6 |
| Fengsizhan 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 1 | 6 |
| Baitaixiangzhan | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 5 |
| IR76479-48-1-3-1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 4 |
| IR72903-99-2-3-2 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 5 |
| Zhaitang | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 3 |
| Xuxiaoqu 10 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 6 |
| 062A1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 5 |
| N11 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 6 |
| A10 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 6 |
| C3 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 1 | 7 |
| Yunjing 136 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 5 |
| Zhongle 8610 | 1 | 1 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 6 |
| 41 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 6 |
| 43 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 5 |
| 488 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 1 | 6 |
| 6003 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 1 | 1 | 9 |
| 6004 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 6 |
| 6020 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 5 |
| 6021 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 5 |
| 6181 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 1 | 1 | 7 |
| 237-1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 1 | 1 | 7 |
| 237-2 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 1 | 1 | 9 |
| 1579 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 1 | 1 | 0 | 0 | 6 |
| R gene frequency (%) | 100.0 | 100.0 | 87.5 | 37.5 | 9.4 | 12.5 | 34.4 | 96.9 | 34.4 | 28.1 | 43.8 | |
| a, ‘1’ represents presence of amplicon and ‘0’ represents absence of amplicon. | ||||||||||||
| 1 | Bryan G T, Wu K S, Farrall L, Jia Y L, Hershey H P, McAdams S A, Faulk K N, Donaldson G K, Tarchini R, Valent B.2000. A single amino acid difference distinguishes resistant and susceptible alleles of the rice blast resistance gene Pita.Plant Cell, 12: 2033-2045. |
| 2 | Chen X W, Shang J J, Chen D X, Lei C L, Zou Y, Zhai W X, Liu G Z, Xu J C, Ling Z Z, Cao G, Ma B T, Wang Y P, Zhao X F, Li S G, Zhu L H.2006. A B-lectin receptor kinase gene conferring rice blast resistance.Plant J, 46(5): 794-804. |
| 3 | Cho Y C, Kwon S W, Choi I S, Lee S K, Jeon J S, Oh M K, Roh J H, Hwang H G, Yang S J, Kim Y G.2007. Identification of major blast resistance genes in Korean rice varieties (Oryza sativa L.) using molecular markers.J Crop Sci Biotechnol, 10(4): 265-276. |
| 4 | Fukuoka S, Yamamoto S I, Mizobuchi R, Yamanouchi U, Ono K, Kitazawa N, Yasuda N, Fujita Y, Nguyen T T T, Koizumi S, Sugimoto K, Matsumoto T, Yano M.2014. Multiple functional polymorphisms in a single disease resistance gene in rice enhance durable resistance to blast.Sci Rep, 4: 4550. |
| 5 | Hayashi K, Hashimoto N, Daigen M, Ashikawa I.2004. Development of PCR-based SNP markers for rice blast resistance genes at the Pi-z locus.Theor Appl Genet, 108(7): 1212-1220. |
| 6 | Hayashi K, Yoshida H, Ashikawa I.2006. Development of PCR-based allele specific and InDel marker sets for nine rice blast resistance genes.Theor Appl Genet, 113(2): 251-260. |
| 7 | Imam J, Alam S, Variar M, Shukla P.2013. Identification of rice blast resistance gene Pi-9 from Indian rice land races with STS marker and its verification by virulence analysis.Proc Natl Acad Sci Ind Sec B: Biol Sci, 83(4): 499-504. |
| 8 | Imam J, Alam S, Mandal N P, Variar M, Shukla P.2014. Molecular screening for identification of blast resistance genes in north east and eastern Indian rice germplasm (Oryza sativa L.) with PCR based markers. Euphytica, 196(2): 199-211. |
| 9 | International Rice Research Institute (IRRI). 1996. Standard Evaluation System. Manila, the Philippines: IRRI: 52. |
| 10 | Jia Y L, Wang Z H, Singh P.2002. Development of dominant rice blast Pi-ta resistance gene markers.Crop Sci, 42(6): 2145-2149. |
| 11 | Jia Y L, Redus M, Wang Z H, Rutger J N.2004. Development of a SNLP marker from the Pi-ta blast resistance gene by tri-primer PCR.Euphytica, 138(1): 97-105. |
| 12 | Jin C P, Sun G, Liu J L, Li G H, Zhang S H, Pan H Y.2011. Identification of rice varieties resistant to rice blast in Jilin Province.Agta Agric Boreali-Sin, 26(3): 214-218. (in Chinese with English abstract) |
| 13 | Khush G S, Jena K K.2009. Current status and future prospects for research on blast resistance in rice (Oryza sativa L.). In: Wang G L, Valent B. Advances in Genetics, Genomics and Control of Rice Blast Disease. New York, USA: Springer: 1-10. |
| 14 | Kim J S, Ahn S N, Kim C K, Shim C K.2010. Screening of rice blast resistance genes from aromatic rice germplasms with SNP markers.Plant Pathol J, 26: 70-79. |
| 15 | Latif M A, Badsha M A, Tajul M I, Kabir M S, Rafii M Y, Mia M A T.2011. Dentification of genotypes resistant to blast, bacterial leaf blight, sheath blight and tungro and efficacy of seed treating fungicides against blast disease of rice.Sci Res Essays, 6(13): 2804-2811. |
| 16 | Lei C L, Wang J L, Mao S H, Zhu L H, Ling Z Z.1996. Genetic analysis of blast resistance in indica variety Zhaiyeqing 8 (ZYQ8).Chin J Genet, 23: 287-293. |
| 17 | Ma J, Lei C L, Xu X T, Hao K, Wang J L, Cheng Z J, Ma X D, Ma J, Zhou K N, Zhang X, Guo X P, Wu F Q, Lin Q B, Wang C M, Zhai H Q, Wang H Y, Wan J M.2015. Pi-64, encoding a novel CC-NBS-LRR protein, confers resistance to leaf and neck blast in rice. Mol Plant-Microbe Inter, 28(5): 558-568. |
| 18 | Miah G, Rafii M Y, Ismail M R, Puteh A B, Rahim H A, Islam K N, Latif M A.2013. A review of microsatellite markers and their applications in rice breeding programs to improve blast disease resistance.Int J Mol Sci, 14(11): 22499-22528. |
| 19 | Peng S B, Tang Q Y, Zou Y B.2009. Current status and challenges of rice production in China.Plant Prod Sci, 12(1): 1-6. |
| 20 | Qu S H, Liu G F, Zhou B, Bellizzi M, Zeng L R, Dai L Y, Han B, Wang G L.2006. The broad-spectrum blast resistance gene Pi-9 encodes a nucleotide-binding site-leucine-rich repeat protein and is a member of a multigene family in rice.Genetics, 172: 1901-1914. |
| 21 | RiceDate. 2012. . |
| 22 | RoyChowdhury M, Jia Y, Jackson A, Jia M H, Fjellstrom R, Cartwright R.2012a. Analysis of rice blast resistance gene Pi-z using pathogenicity assays and DNA markers.Euphytica, 184(1): 35-46. |
| 23 | RoyChowdhury M, Jia Y, Jia M H, Fjellstrom R, Cartwright R.2012b. Identification of the rice blast resistance gene Pi-b in the national small grains collection.Phytopathology, 102: 700-706. |
| 24 | Rybka K, Miyamoto M, Ando I, Saito A, Kawasaki S.1997. High resolution mapping of the indica-derived rice blast resistance genes: II. Pi-ta2 and Pi-ta and a consideration of their origin.Mol Plant-Microbe Inter, 10(4): 517-524. |
| 25 | Sharma T R, Madhav M S, Singh B K, Shanker P, Jana T K, Dalal V, Pandit A, Singh A, Gaikwad K, Upreti H C, Singh N K.2005. High-resolution mapping, cloning and molecular characterization of the gene of rice, which confers resistance to rice blast.Mol Genet Genom, 274(6): 569-578. |
| 26 | Singh A K, Singh P K, Arya M, Singh N K, Singh U S.2015. Molecular screening of blast resistance genes in rice using SSR markers. Plant Pathol J, 31(1): 12-24. |
| 27 | Sun G.2012. Distirbutinon of resistance genes in rice and avirulence genes in rice blast fungus and molecule detection of Magnaporthe oryzae. Jinlin, China: University of Jinlin. (in Chinese with English abstract) |
| 28 | Tanksley S D, McCouch S R.1997. Seeds banks and molecular maps: Unlocking genetic potential from the wild.Science, 277: 1063-1066. |
| 29 | Vasudevan K, Vera Cruz C M, Gruissem W, Bhullar N K.2014. Large scale germplasm screening for identification of novel rice blast resistance sources.Front Plant Sci, 5: 505. |
| 30 | Wang C, Hirano K, Kawasaki S.2002. Cloning of Pi-ta2 in the centromeric region of chr12 with HEGS: High efficiency genome scanning. In: Third International Rice Blast Conference: 25. |
| 31 | Wang Y H, Li J Y.2005. The plant architecture of rice (Oryza sativa).Plant Mol Biol, 59(1): 75-84. |
| 32 | Warude D, Chavan P, Joshi K, Patwardhan B.2003. DNA isolation from fresh and dry plant samples with highly acidic tissue extracts.Plant Mol Biol Rep, 21(4): 467. |
| [1] | Prathap V, Suresh KUMAR, Nand Lal MEENA, Chirag MAHESHWARI, Monika DALAL, Aruna TYAGI. Phosphorus Starvation Tolerance in Rice Through a Combined Physiological, Biochemical and Proteome Analysis [J]. Rice Science, 2023, 30(6): 8-. |
| [2] | Serena REGGI, Elisabetta ONELLI, Alessandra MOSCATELLI, Nadia STROPPA, Matteo Dell’ANNO, Kiril PERFANOV, Luciana ROSSI. Seed-Specific Expression of Apolipoprotein A-IMilano Dimer in Rice Engineered Lines [J]. Rice Science, 2023, 30(6): 6-. |
| [3] | Sundus ZAFAR, XU Jianlong. Recent Advances to Enhance Nutritional Quality of Rice [J]. Rice Science, 2023, 30(6): 4-. |
| [4] | Kankunlanach KHAMPUANG, Nanthana CHAIWONG, Atilla YAZICI, Baris DEMIRER, Ismail CAKMAK, Chanakan PROM-U-THAI. Effect of Sulfur Fertilization on Productivity and Grain Zinc Yield of Rice Grown under Low and Adequate Soil Zinc Applications [J]. Rice Science, 2023, 30(6): 9-. |
| [5] | FAN Fengfeng, CAI Meng, LUO Xiong, LIU Manman, YUAN Huanran, CHENG Mingxing, Ayaz AHMAD, LI Nengwu, LI Shaoqing. Novel QTLs from Wild Rice Oryza longistaminata Confer Rice Strong Tolerance to High Temperature at Seedling Stage [J]. Rice Science, 2023, 30(6): 14-. |
| [6] | LIN Shaodan, YAO Yue, LI Jiayi, LI Xiaobin, MA Jie, WENG Haiyong, CHENG Zuxin, YE Dapeng. Application of UAV-Based Imaging and Deep Learning in Assessment of Rice Blast Resistance [J]. Rice Science, 2023, 30(6): 10-. |
| [7] | Md. Forshed DEWAN, Md. AHIDUZZAMAN, Md. Nahidul ISLAM, Habibul Bari SHOZIB. Potential Benefits of Bioactive Compounds of Traditional Rice Grown in South and South-East Asia: A Review [J]. Rice Science, 2023, 30(6): 5-. |
| [8] | Raja CHAKRABORTY, Pratap KALITA, Saikat SEN. Phenolic Profile, Antioxidant, Antihyperlipidemic and Cardiac Risk Preventive Effect of Chakhao Poireiton (A Pigmented Black Rice) in High-Fat High-Sugar induced Rats [J]. Rice Science, 2023, 30(6): 11-. |
| [9] | LI Qianlong, FENG Qi, WANG Heqin, KANG Yunhai, ZHANG Conghe, DU Ming, ZHANG Yunhu, WANG Hui, CHEN Jinjie, HAN Bin, FANG Yu, WANG Ahong. Genome-Wide Dissection of Quan 9311A Breeding Process and Application Advantages [J]. Rice Science, 2023, 30(6): 7-. |
| [10] | JI Dongling, XIAO Wenhui, SUN Zhiwei, LIU Lijun, GU Junfei, ZHANG Hao, Tom Matthew HARRISON, LIU Ke, WANG Zhiqin, WANG Weilu, YANG Jianchang. Translocation and Distribution of Carbon-Nitrogen in Relation to Rice Yield and Grain Quality as Affected by High Temperature at Early Panicle Initiation Stage [J]. Rice Science, 2023, 30(6): 12-. |
| [11] | Nazaratul Ashifa Abdullah Salim, Norlida Mat Daud, Julieta Griboff, Abdul Rahim Harun. Elemental Assessments in Paddy Soil for Geographical Traceability of Rice from Peninsular Malaysia [J]. Rice Science, 2023, 30(5): 486-498. |
| [12] | Monica Ruffini Castiglione, Stefania Bottega, Carlo Sorce, Carmelina SpanÒ. Effects of Zinc Oxide Particles with Different Sizes on Root Development in Oryza sativa [J]. Rice Science, 2023, 30(5): 449-458. |
| [13] | Tan Jingyi, Zhang Xiaobo, Shang Huihui, Li Panpan, Wang Zhonghao, Liao Xinwei, Xu Xia, Yang Shihua, Gong Junyi, Wu Jianli. ORYZA SATIVA SPOTTED-LEAF 41 (OsSPL41) Negatively Regulates Plant Immunity in Rice [J]. Rice Science, 2023, 30(5): 426-436. |
| [14] | Ammara Latif, Sun Ying, Pu Cuixia, Noman Ali. Rice Curled Its Leaves Either Adaxially or Abaxially to Combat Drought Stress [J]. Rice Science, 2023, 30(5): 405-416. |
| [15] | Liu Qiao, Qiu Linlin, Hua Yangguang, Li Jing, Pang Bo, Zhai Yufeng, Wang Dekai. LHD3 Encoding a J-Domain Protein Controls Heading Date in Rice [J]. Rice Science, 2023, 30(5): 437-448. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||