
Rice Science ›› 2020, Vol. 27 ›› Issue (2): 143-151.DOI: 10.1016/j.rsci.2020.01.005
• Research Paper • Previous Articles Next Articles
Wenli Zou1,2, Chang Li3, Yajun Zhu2, Jingguang Chen2(
), Haohua He1(
), Guoyou Ye2
Received:2019-01-10
Accepted:2019-05-09
Online:2020-03-28
Published:2019-11-28
About author:#These authors contributed equally to this work
Wenli Zou, Chang Li, Yajun Zhu, Jingguang Chen, Haohua He, Guoyou Ye. Rice Heavy Metal P-type ATPase OsHMA6 Is Likely a Copper Efflux Protein[J]. Rice Science, 2020, 27(2): 143-151.
Add to citation manager EndNote|Ris|BibTeX
| Gene name | Forward primer (5′ to 3′) | Reverse primer (5′ to 3′) |
|---|---|---|
| OsActin | GGAACTGGTATGGTCAAGGC | AGTCTCATGGATAACCGCAG |
| OsHMA6 | GGGACAGTCTTGAGCCAGAT | TCCGCAAAGAAACCATGCAA |
| OsHMA9 | GTTGTCGGCAAACGGTTCTA | AACCCAGTGAATGCTCCGTA |
Supplemental Table 1. Primers used for qRT-PCR.
| Gene name | Forward primer (5′ to 3′) | Reverse primer (5′ to 3′) |
|---|---|---|
| OsActin | GGAACTGGTATGGTCAAGGC | AGTCTCATGGATAACCGCAG |
| OsHMA6 | GGGACAGTCTTGAGCCAGAT | TCCGCAAAGAAACCATGCAA |
| OsHMA9 | GTTGTCGGCAAACGGTTCTA | AACCCAGTGAATGCTCCGTA |
Fig. 1. Phylogenic tree of HMA proteins of Arabidopsis and rice. The phylogenetic tree was constructed using the Neighbor-Joining method with 1000 bootstrap replicates in MEGA 7.0. Green indicates the Cu/Ag subgroup and pink indicates the Zn/Cd/Co/Pb subgroup. The amino sequences of rice and Arabidopsis HMA genes were downloaded from the Rice Genome Annotion Project (http://rice.plantbiology.msu.edu/annotation.shtml) and Tair (https://www.arabidopsis.org/).OsHMA1, LOC_Os06g47550; OsHMA2, LOC_ Os06g48720; OsHMA3, LOC_Os07g12900; OsHMA4, LOC_Os02g10290; OsHMA5, LOC_Os04g46940; OsHMA6, LOC_Os02g07630; OsHMA7, LOC_ Os08g37950; OsHMA8, LOC_Os03g08070; OsHMA9, LOC_Os06g45500.
| OsHMA | OsHMA1 | OsHMA2 | OsHMA3 | OsHMA4 | OsHMA5 | OsHMA6 | OsHMA7 | OsHMA8 |
|---|---|---|---|---|---|---|---|---|
| OsHMA2 | 16.58 | 25.59 | ||||||
| OsHMA3 | 18.4 | 45.88 | ||||||
| OsHMA4 | 18.49 | 12.99 | 13.98 | |||||
| OsHMA5 | 17.19 | 10.37 | 13.82 | 53.14 | ||||
| OsHMA6 | 16.95 | 11.55 | 12.88 | 45.54 | 45.38 | |||
| OsHMA7 | 20.04 | 12.63 | 19.23 | 28.88 | 28.69 | 27.34 | ||
| OsHMA8 | 20.28 | 10.77 | 19.96 | 26 | 25.91 | 24.22 | 36.65 | |
| OsHMA9 | 17.68 | 10.35 | 12.57 | 44.97 | 45.56 | 82.78 | 26.61 |
Table 1 Percentage of amino acid sequence similarity among OsHMAs. %
| OsHMA | OsHMA1 | OsHMA2 | OsHMA3 | OsHMA4 | OsHMA5 | OsHMA6 | OsHMA7 | OsHMA8 |
|---|---|---|---|---|---|---|---|---|
| OsHMA2 | 16.58 | 25.59 | ||||||
| OsHMA3 | 18.4 | 45.88 | ||||||
| OsHMA4 | 18.49 | 12.99 | 13.98 | |||||
| OsHMA5 | 17.19 | 10.37 | 13.82 | 53.14 | ||||
| OsHMA6 | 16.95 | 11.55 | 12.88 | 45.54 | 45.38 | |||
| OsHMA7 | 20.04 | 12.63 | 19.23 | 28.88 | 28.69 | 27.34 | ||
| OsHMA8 | 20.28 | 10.77 | 19.96 | 26 | 25.91 | 24.22 | 36.65 | |
| OsHMA9 | 17.68 | 10.35 | 12.57 | 44.97 | 45.56 | 82.78 | 26.61 |
Fig. 2. Expression levels of OsHMA6 and OsHMA9 in different organs at different growth stages. Samples were taken from rice cultivar Wuyunjing 7 grown in a paddy field. Rice OsActin (NM_197297) was used as a reference gene. Values are Mean ± SE (n = 3).
Fig. 3. Dose-responses of OsHMA6 and OsHMA9 expression. A and B, OsHAM6 and OsHMA9 expression in response to Cu2+, respectively. C and D, OsHMA6 and OsHMA9 expression in response to Cd2+, respectively. The rice cultivar Wuyunjing 7 seedlings at 14-day-old were treated for 3 d under nutrient solution with different concentrations of Cu2+ or Cd2+. RNA was extracted from rice roots. Rice OsActin (NM_197297) was used as a reference gene. Values are Mean ± SE (n = 3). The different letters above the bars indicate a significant difference between the control and treatments (P < 0.01).
Fig. 4. Transport activity of OsHMA6 in yeast.A and B, Overnight yeast cell suspension of CM52 transformed with empty vector pYES2 or OsHMA6-pYES2 were serially diluted (1:10) and spotted on the solid media containing 0, 3 and 6 mmol/L CuSO4 (A) or 0, 10 and 20 μmol/L CdCl2 (B). Pictures were taken after 3 d growth at 30 ºC.
Fig. 5. Functional assay of OsHMA6 by heterologous expression in yeast. A?D, Yeast strains were grown in liquid media without Cu2+ and Cd2+ (A), with 3 mmol/L CuSO4 (B), 6 mmol/L CuSO4 (C), or 20 μmol/L CdCl2 (D) for 30 h. The absorbance at 600 nm (OD600) of cell cultures was measured every 5 h. E and F, Effects of OsHMA6 expression on Cd (E) and Cu (F) accumulation in yeast cells. The dried strains in E and F were determined at 30 h treatment. Values are Mean ± SE (n = 3). Asterisks indicate significant differences between strains transformed with empty vector and strains expressing OsHMA6 (P < 0.01).
Fig. 6. Subcellular localization of OsHMA6 protein. The OsHMA6:GFP construct was transformed into Arabidopsis mesophyll protoplasts and detected by a laser scanning microscope (LSM410; Carl Zeiss, Germany). Scale bars = 10 μm.
| [1] | Abdel-Ghany S E, Müller-Moulé P, Niyogi K K, Pilon M, Shikanai T. 2005. Two P-type ATPases are required for copper delivery in Arabidopsis thaliana chloroplasts. Plant Cell, 17(4): 1233-1251. |
| [2] | Alaoui-Sossé B, Genet P, Vinit-Dunand F, Toussaint M L, Epron D, Badot P M. 2004. Effect of copper on growth in cucumber plants (Cucumis sativus) and its relationships with carbohydrate accumulation and changes in ion contents. Plant Sci, 166(5): 1213-1218. |
| [3] | Andrés-Colás N, Sancenon V, Rodriguez-Navarro S, Mayo S, Thiele D J, Ecker J R, Puig S, Penarrubia L. 2006. The Arabidopsis heavy metal P-type ATPase HMA5 interacts with metallochaperones and functions in copper detoxification of roots. Plant J, 45(2): 225-236. |
| [4] | Andrés-Colás N, Perea-García A, Puig S, Peñarrubia L. 2010. Deregulated copper transport affects Arabidopsis development especially in the absence of environmental cycles. Plant Physiol, 153(1): 170-184. |
| [5] | Argüello J M, Eren E, González-Guerrero M. 2007. The structure and function of heavy metal transport P1B-ATPases. BioMetals, 20: 233-248. |
| [6] | Barberon M, Geldner N. 2014. Radial transport of nutrients: The plant root as a polarized epithelium. Plant Physiol, 166(2): 528-537. |
| [7] | Bernal M, Roncel M, Ortega J M, Picorel R, Yruela I. 2004. Copper effect on cytochrome b of photosystem II under photoinhibitory conditions. Physiol Plant, 120(4): 686-694. |
| [8] | Bernal M, Ramiro M V, Cases R, Picorel R, Yruela I. 2006. Excess copper effect on growth, chloroplast ultrastructure, oxygen- evolution activity and chlorophyll fluorescence in glycine max cell suspensions. Physiol Plant, 127(2): 312-325. |
| [9] | Burkhead J L, Reynolds K A, Abdel-Ghany S E, Cohu C M, Pilon M. 2009. Copper homeostasis. New Phytol, 182(4): 799-816. |
| [10] | Che J, Yamaji N, Ma J F. 2018. Efficient and flexible uptake system for mineral elements in plants. New Phytol, 219(2): 513-517. |
| [11] | Colangelo E P, Guerinot M L. 2006. Put the metal to the petal: Metal uptake and transport throughout plants. Curr Opin Plant Biol, 9(3): 322-330. |
| [12] | Collins J F, Klevay L M. 2011. Copper. Adv Nutr, 2(6): 520-522. |
| [13] | Deng F L, Yamaji N, Xia J X, Ma J F. 2013. A member of the heavy metal P-type ATPase OsHMA5 is involved in xylem loading of copper in rice. Plant Physiol, 163(3): 1353-1362. |
| [14] | Gulec S, Collins J F. 2014. Molecular mediators governing iron-copper interactions. Annu Rev Nutr, 34: 95-116. |
| [15] | Hansch R, Mendel R R. 2009. Physiological functions of mineral micronutrients (Cu, Zn, Mn, Fe, Ni, Mo, B, Cl). Curr Opin Plant Biol, 12(3): 259-266. |
| [16] | Huang X Y, Deng F L, Yamaji N, Pinson S R M, Fujii-Kashino M, Danku J, Douglas A, Guerinot M L, Salt D E, Ma J F. 2016. A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain. Nat Commun, 7: 12138. |
| [17] | Hussain D, Haydon M J, Wang Y W, Wong E, Sherson S M, Young J, Camakaris J, Harper J F, Cobbett C S. 2004. P-type ATPase heavy metal transporters with roles in essential zinc homeostasis in Arabidopsis. Plant Cell, 16(5): 1327-1339. |
| [18] | Jung H I, Gayomba S R, Rutzke M A, Craft E, Kochian L V, Vatamaniuk O K. 2012. COPT6 is a plasma membrane transporter that functions in copper homeostasis in Arabidopsis and is a novel target of SQUAMOSA promoter-binding protein- like 7. J Biol Chem, 287: 33252-33267. |
| [19] | Kampfenkel K, Kushnir S, Babiychuk E, Inze D, van Montagu M. 1995. Molecular characterization of a putative Arabidopsis thaliana copper transporter and its yeast homologue. J Biol Chem, 270: 28479-28486. |
| [20] | Klaumann S, Nickolaus S D, Furst S H, Starck S, Schneider S, Ekkehard Neuhaus H, Trentmann O. 2011. The tonoplast copper transporter COPT5 acts as an exporter and is required for interorgan allocation of copper in Arabidopsis thaliana. New Phytol, 192(2): 393-404. |
| [21] | Kobayashi Y, Kuroda K, Kimura K, Southron-Francis J L, Furuzawa A, Kimura K, Iuchi S, Kobayashi M, Taylor G J, Koyama H. 2008. Amino acid polymorphisms in strictly conserved domains of a P-type ATPase HMA5 are involved in the mechanism of copper tolerance variation in Arabidopsis. Plant Physiol, 148(2): 969-980. |
| [22] | Kong X Y, Liu T, Yu Z H, Chen Z, Lei D, Wang Z W, Zhang H, Li Q H, Zhang S S. 2018. Heavy metal bioaccumulation in rice from a high geological background area in Guizhou Province, China. Int J Environ Res Pub Health, 15(10): E2281. |
| [23] | Lee S, Kim Y Y, Lee Y, An G. 2007. Rice P1B-type heavy-metal ATPase, OsHMA9, is a metal efflux protein. Plant Physiol, 145(3): 831-842. |
| [24] | Lequeux H, Hermans C, Lutts S, Verbruggen N. 2010. Response to copper excess in Arabidopsis thaliana: Impact on the root system architecture, hormone distribution, lignin accumulation and mineral profile. Plant Physiol Biochem, 48(8): 673-682. |
| [25] | Li N N, Xiao H, Sun J J, Wang S F, Wang J C, Chang P, Zhou X B, Lei B, Lu K, Luo F, Shi X J, Li J N. 2018. Genome-wide analysis and expression profiling of the HMA gene family in Brassica napus under Cd stress. Plant Soil, 426: 365-381. |
| [26] | Li Y B, Iqbal M, Zhang Q Q, Spelt C, Bliek M, Hakvoort H W J, Quattrocchio F M, Koes R, Schat H. 2017. Two Silene vulgaris copper transporters residing in different cellular compartments confer copper hypertolerance by distinct mechanisms when expressed in Arabidopsis thaliana. New Phytol, 215(3): 1102-1114. |
| [27] | Ma J F, Ueno D, Zhao F J, McGrath S P. 2004. Subcellular localisation of Cd and Zn in the leaves of a Cd-hyper- accumulating ecotype of Thlaspi caerulescens. Planta, 220(5): 731-736. |
| [28] | Migocka M, Papierniak A, Maciaszczyk-Dziubinska E, Posyniak E, Kosieradzka A. 2015a. Molecular and biochemical properties of two P1B2-ATPases, CsHMA3 and CsHMA4, from cucumber. Plant Cell Environ, 38(6): 1127-1141. |
| [29] | Migocka M, Posyniak E, Maciaszczyk-Dziubinska E, Papierniak A, Kosieradzaka A. 2015b. Functional and biochemical characterization of cucumber genes encoding two copper ATPases CsHMA5.1 and CsHMA5.2. J Biol Chem, 290: 15717-15729. |
| [30] | Morel M, Crouzet J, Gravot A, Auroy P, Leonhardt N, Vavasseur A, Richaud P. 2009. AtHMA3, a P1B-ATPase allowing Cd/Zn/Co/Pb vacuolar storage in Arabidopsis. Plant Physiol, 149(2): 894-904. |
| [31] | Navari-Izzo F, Cestone B, Cavallini A, Natali L, Giordani T, Quartacci M F. 2006. Copper excess triggers phospholipase D activity in wheat roots. Phytochemistry, 67(12): 1232-1242. |
| [32] | Pilon M, Abdel-Ghany S E, Cohu C M, Gogolin K A, Ye H. 2006. Copper cofactor delivery in plant cells. Curr Opin Plant Biol, 9(3): 256-263. |
| [33] | Sancenón V, Puig S, Mira H, Thiele D J, Peñarrubia L. 2003. Identification of a copper transporter family in Arabidopsis thaliana. Plant Mol Biol, 51(4): 577-587. |
| [34] | Sancenón V, Puig S, Mateu-Andrés I, Dorcey E, Thiele D J, Peñarrubia L. 2004. The Arabidopsis copper transporter COPT1 functions in root elongation and pollen development. J Biol Chem, 279(15): 15348-15355. |
| [35] | Takahashi R, Bashir K, Ishimaru Y, Nishizawa N K, Nakanishi H. 2012. The role of heavy-metal ATPases, HMAs, in zinc and cadmium transport in rice. Plant Signal Behav, 7(12): 1605-1607. |
| [36] | Ueno D, Yamaji N, Ma J F. 2009. Further characterization of ferric-phytosiderophore transporters ZmYS1 and HvYS1 in maize and barley. J Exp Bot, 60(12): 3513-3520. |
| [37] | Waters B M, Chu H H, Didonato R J, Roberts L A, Eisley R B, Lahner B, Salt D E, Walker E L. 2006. Mutations in Arabidopsis yellow stripe-like1 and yellow stripe-like3 reveal their roles in metal ion homeostasis and loading of metal ions in seeds. Plant Physiol, 141(4): 1446-1458. |
| [38] | White P J, Broadley M R. 2009. Biofortification of crops with seven mineral elements often lacking in human diets: Iron, zinc, copper, calcium, magnesium, selenium and iodine. New Phytol, 182(1): 49-84. |
| [39] | Wintz H, Fox T, Wu Y Y, Feng V, Chen W Q, Chang H S, Zhu T, Vulpe C. 2003. Expression profiles of Arabidopsis thaliana in mineral deficiencies reveal novel transporters involved in metal homeostasis. J Biol Chem, 278: 47644-47653. |
| [40] | Yuan M, Li X H, Xiao J H, Wang S P. 2011. Molecular and functional analyses of COPT/Ctr-type copper transporter-like gene family in rice. BMC Plant Biol, 11: 69. |
| [41] | Zhang C, Lu W H, Yang Y, Shen Z G, Ma J F, Zheng L Q. 2018. OsYSL16 is required for preferential Cu distribution to floral organs in rice. Plant Cell Physiol, 59(10): 2039-2051. |
| [1] | Prathap V, Suresh KUMAR, Nand Lal MEENA, Chirag MAHESHWARI, Monika DALAL, Aruna TYAGI. Phosphorus Starvation Tolerance in Rice Through a Combined Physiological, Biochemical and Proteome Analysis [J]. Rice Science, 2023, 30(6): 8-. |
| [2] | Serena REGGI, Elisabetta ONELLI, Alessandra MOSCATELLI, Nadia STROPPA, Matteo Dell’ANNO, Kiril PERFANOV, Luciana ROSSI. Seed-Specific Expression of Apolipoprotein A-IMilano Dimer in Rice Engineered Lines [J]. Rice Science, 2023, 30(6): 6-. |
| [3] | Sundus ZAFAR, XU Jianlong. Recent Advances to Enhance Nutritional Quality of Rice [J]. Rice Science, 2023, 30(6): 4-. |
| [4] | Kankunlanach KHAMPUANG, Nanthana CHAIWONG, Atilla YAZICI, Baris DEMIRER, Ismail CAKMAK, Chanakan PROM-U-THAI. Effect of Sulfur Fertilization on Productivity and Grain Zinc Yield of Rice Grown under Low and Adequate Soil Zinc Applications [J]. Rice Science, 2023, 30(6): 9-. |
| [5] | FAN Fengfeng, CAI Meng, LUO Xiong, LIU Manman, YUAN Huanran, CHENG Mingxing, Ayaz AHMAD, LI Nengwu, LI Shaoqing. Novel QTLs from Wild Rice Oryza longistaminata Confer Rice Strong Tolerance to High Temperature at Seedling Stage [J]. Rice Science, 2023, 30(6): 14-. |
| [6] | LIN Shaodan, YAO Yue, LI Jiayi, LI Xiaobin, MA Jie, WENG Haiyong, CHENG Zuxin, YE Dapeng. Application of UAV-Based Imaging and Deep Learning in Assessment of Rice Blast Resistance [J]. Rice Science, 2023, 30(6): 10-. |
| [7] | Md. Forshed DEWAN, Md. AHIDUZZAMAN, Md. Nahidul ISLAM, Habibul Bari SHOZIB. Potential Benefits of Bioactive Compounds of Traditional Rice Grown in South and South-East Asia: A Review [J]. Rice Science, 2023, 30(6): 5-. |
| [8] | Raja CHAKRABORTY, Pratap KALITA, Saikat SEN. Phenolic Profile, Antioxidant, Antihyperlipidemic and Cardiac Risk Preventive Effect of Chakhao Poireiton (A Pigmented Black Rice) in High-Fat High-Sugar induced Rats [J]. Rice Science, 2023, 30(6): 11-. |
| [9] | LI Qianlong, FENG Qi, WANG Heqin, KANG Yunhai, ZHANG Conghe, DU Ming, ZHANG Yunhu, WANG Hui, CHEN Jinjie, HAN Bin, FANG Yu, WANG Ahong. Genome-Wide Dissection of Quan 9311A Breeding Process and Application Advantages [J]. Rice Science, 2023, 30(6): 7-. |
| [10] | JI Dongling, XIAO Wenhui, SUN Zhiwei, LIU Lijun, GU Junfei, ZHANG Hao, Tom Matthew HARRISON, LIU Ke, WANG Zhiqin, WANG Weilu, YANG Jianchang. Translocation and Distribution of Carbon-Nitrogen in Relation to Rice Yield and Grain Quality as Affected by High Temperature at Early Panicle Initiation Stage [J]. Rice Science, 2023, 30(6): 12-. |
| [11] | Nazaratul Ashifa Abdullah Salim, Norlida Mat Daud, Julieta Griboff, Abdul Rahim Harun. Elemental Assessments in Paddy Soil for Geographical Traceability of Rice from Peninsular Malaysia [J]. Rice Science, 2023, 30(5): 486-498. |
| [12] | Monica Ruffini Castiglione, Stefania Bottega, Carlo Sorce, Carmelina SpanÒ. Effects of Zinc Oxide Particles with Different Sizes on Root Development in Oryza sativa [J]. Rice Science, 2023, 30(5): 449-458. |
| [13] | Tan Jingyi, Zhang Xiaobo, Shang Huihui, Li Panpan, Wang Zhonghao, Liao Xinwei, Xu Xia, Yang Shihua, Gong Junyi, Wu Jianli. ORYZA SATIVA SPOTTED-LEAF 41 (OsSPL41) Negatively Regulates Plant Immunity in Rice [J]. Rice Science, 2023, 30(5): 426-436. |
| [14] | Ammara Latif, Sun Ying, Pu Cuixia, Noman Ali. Rice Curled Its Leaves Either Adaxially or Abaxially to Combat Drought Stress [J]. Rice Science, 2023, 30(5): 405-416. |
| [15] | Liu Qiao, Qiu Linlin, Hua Yangguang, Li Jing, Pang Bo, Zhai Yufeng, Wang Dekai. LHD3 Encoding a J-Domain Protein Controls Heading Date in Rice [J]. Rice Science, 2023, 30(5): 437-448. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||