Quinclorac Resistance in Echinochloa crus-galli from China

doi:10.1016/j.rsci.2019.08.004

Abstract

Abstract:

Echinochloa crus-galli is a major weed in rice fields in China, and quinclorac has been long used for its control. Over-reliance of quinclorac has resulted in quinclorac resistance in E. crus-galli. Two resistant (R) E. crus-galli populations from Hunan, China were confirmed to be at least 78-fold more resistant to quinclorac than the susceptible (S) population. No difference in foliar uptake of ¹⁴C-labelled quinclorac was detected between the R and S plants. However, a higher level of ¹⁴C translocation and a lower level of quinclorac metabolism were found in the R plants. Basal and induced expression levels of β-cyanoalanine synthase (β-CAS) gene and β-CAS activity were not significantly different between the R and S plants. However, the induction expression of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1) gene by quinclorac treatment was evident in the S plants but not in the R plants. Quinclorac resistance in the two resistant E. crus-galli populations was not likely to be related to foliar uptake, translocation or metabolism of quinclorac, nor to cyanide detoxification via β-CAS. Thus, target-site based quinclorac signal reception and transduction and regulation of the ethylene synthesis pathway should be the focus for further research.

Key words: Echinochloa crus-galli, quinclorac resistance, quinclorac metabolism, β-cyanoalanine synthase, 1-aminocyclopropane-1-carboxylic acid synthase, 1-aminocyclopropane-1-carboxylic acid oxidase, rice

Qiong Peng, Heping Han, Xia Yang, Lianyang Bai, Qin Yu, B. Powles Stephen. Quinclorac Resistance in Echinochloa crus-galli from China[J]. Rice Science, 2019, 26(5): 300-308.

Figures/Tables 9

References 38

[1]	Bajwa A A, Jabran K, Shahid M, Ali H H, Chauhan B S, Ehsanullah.2015. Eco-biology and management ofEchinochloa crus-galli. Crop Prot, 75: 151-162.
[2]	Chayapakdee P, Iwakami S, Kamidate Y, Uchino A, Fan L, Sunohara S, Matsumoto H.2017. Enhanced activity of β-cyanoalanine synthase does not confer quinclorac resistance in multiple-herbicide resistant Echinochloa phyllopogon. The 26th Asian-Pacific Weed Science Society Conference, Weed Science for People, Agriculture and Nature. Kyoto, Japan.
[3]	Chen G Q, Wang Q, Yao Z W, Zhu L F, Dong L Y.2016. Penoxsulam-resistant barnyardgrass (Echinochloa crus-galli) in rice fields in China. Weed Biol Manag, 16(1): 16-23.
[4]	Chen J Y, Yu Q, Owen M, Han H P, Powles S.2018. Dinitroaniline herbicide resistance in a multiple-resistant Lolium rigidum population. Pest Manag Sci, 74: 925-932.
[5]	Chen T, Zhang S L, Zhao L, Zhang Y D, Zhu Z, Zhao Q Y, Zhou L H, Yao S, Zhao C F, Liang W H, Wang C L.2018. Development and verification of a functional marker associated with resistance to ALS inhibitor herbicide.Chin J Rice Sci, 32(2): 137-145. (in Chinese with English abstract)
[6]	Christoffoletti P J, de Figueiredo M R A, Peres L E P, Nissen S, Gaines T.2015. Auxinic herbicides, mechanisms of action, and weed resistance: A look into recent plant science advances. Sci Agric, 72(4): 356-362.
[7]	Fipke M V, Vidal R A.2016. Integrative theory of the mode of action of quinclorac: Literature review.Planta Dan, 34(2): 393-402.
[8]	Gao Y, Pan L, Sun Y, Zhang T, Dong L Y, Li J.2017. Resistance to quinclorac caused by the enhanced ability to detoxify cyanide and its molecular mechanism in Echinochloa crus-galli var. zelayensis. Pestic Biochem Physiol, 143: 231-238.
[9]	Gao Y, Li J, Pan X K, Liu D R, Napier R, Dong L Y.2018. Quinclorac resistance induced by the suppression of the expression of 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase genes in Echinochloa crus-galli var. zelayensis. Pestic Biochem Physiol, 146: 25-32.
[10]	Grossmann K, Kwiatkowski J.1993. Selective induction of ethylene and cyanide biosynthesis appears to be involved in the selectivity of the herbicide quinclorac between rice and barnyard grass.J Plant Physiol, 142(6): 457-466.
[11]	Grossmann K, Kwiatkowski J.1995. Evidence for a causative role of cyanide, derived from ethylene biosynthesis, in the herbicide mode of action of quinclorac in barnyard grass.Pestic Biochem Physiol, 51(2): 150-160.
[12]	Grossmann K, Kwiatkowski J.2000. The mechanism of quinclorac selectivity in grasses.Pestic Biochem Physiol, 66(2): 83-91.
[13]	Grossmann K.2003. Mediation of herbicide effects by hormone interactions.J Plant Growth Regul, 22(1): 109-122.
[14]	Grossmann K.2010. Auxin herbicides: Current status of mechanism and mode of action.Pest Manag Sci, 66: 113-120.
[15]	Gleason C, Foley R C, Singh K B.2011. Mutant analysis in Arabidopsis provides insight into the molecular mode of action of the auxinic herbicide dicamba. PLoS One, 6(3): e17245.
[16]	Guo L B, Qiu J, Ye C Y, Jin G L, Mao L F, Zhang H Q, Yang X F, Peng Q, Wang Y Y, Jia L, Lin Z X, Li G M, Fu F, Liu C, Chen L, Shen E H, Wang W D, Chu Q J, Wu S Y, Wu S L, Xia C Y, Zhang Y F, Zhou X M, Wang L F, Wu L M, Song W J, Wang Y F, Shu Q Y, Aoki D, Yumoto E, Lou Y G, Qian Q, Yamguchi H, Yamane H, Kong C H, Timko M P, Bai L Y, Fan L J.2017. Echinochloa crus-galli genome analysis provides insight into its adaptation and invasiveness as a weed. Nat Commun, 8: 1031.
[17]	Heap I.2018. International survey of herbicide resistant weeds. .
[18]	Hoyerova K, Hosek P, Quareshy M, Li J, Klima P, Kubes M, Yemm A A, Neve P, Tripathi A, Bennett M J, Napier R M.2018. Auxin molecular field maps define AUX1 selectivity: Many auxin herbicides are not substrates.New Phytol, 217(4): 1625-1639.
[19]	Lamoureux G L, Rusness D G.1995. Quinclorac absorption, translocation, metabolism, and toxicity in leafy spurge (Euphorbia esula). Pestic Biochem Physiol, 53(3): 210-226.
[20]	LeClere S, Wu C X, Westra P, Sammons R D.2018. Cross- resistance to dicamba, 2,4-D, and fluroxypyr in Kochia scoparia is endowed by a mutation in an AUX/IAA gene. Proc Natl Acad Sci USA, 115(13): 2911-2920.
[21]	Li G, Xu M F, Chen L P, Cai L M, Bai L Y, Wu C X.2016. A novel EcGH3 gene with a different expression pattern in quinclorac- resistant and susceptible barnyardgrass(Echinochloa crus-galli). Plant Gene, 5: 65-70.
[22]	Lopez-Martinez N, de Prado R.1996. Fate of quinclorac in resistant Echinochloa crus-galli. In: Second International Weed Control Congress. Copenhagen, Denmark: Eurekamag: 535-540.
[23]	Lopez-Martinez N, Marshall G, de Prado R.1997. Resistance of barnyardgrass (Echinochloa crus-galli) to atrazine and quinclorac. Pest Manag Sci, 51(2): 171-175.
[24]	Lovelace M L, Talbert R E, Hoagland R E, Scherder E F.2007. Quinclorac absorption and translocation characteristics in quinclorac- and propanil-resistant and -susceptible barnyardgrass (Echinochloa crus-galli) biotypes. Weed Technol, 21(3): 683-687.
[25]	Ma G L, Liu D C, Liu X Y, Tang T, Peng Y J.2013. Resistance of barnyard grass ( Echinochloa crus-galli) to quinclorac in double-harvest rice area in Hunan Province of China. Plant Dis Pests, 4: 23-27.
[26]	Oerke E C, Dehne H W.2004. Safeguarding production-losses in major crops and the role of crop protection.Crop Prot, 23(4): 275-285.
[27]	Rouse C E, Roma-Burgos N, Norsworthy J K, Tseng T M, Starkey C E, Scott R C.2018. Echinochloa resistance to herbicides continues to increase in Arkansas rice fields. Weed Technol, 32(1): 34-44.
[28]	Sunohara Y, Matsumoto H.2004. Oxidative injury induced by the herbicide quinclorac onEchinochloa oryzicola vasing. and the involvement of antioxidative ability in its highly selective action in grass species. Plant Sci, 167(3): 597-606.
[29]	Takahashi M, Umetsu K, Oono Y, Higaki T, Blancaflor E B, Rahman A.2017. Small acidic protein 1 and SCFTIR1 ubiquitin proteasome pathway act in concert to induce 2,4-dichlorophenoxyacetic acid-mediated alteration of actin in Arabidopsis roots. Plant J, 89(5): 940-956.
[30]	Talbert R E, Burgos N R.2007. History and management of herbicide-resistant barnyardgrass (Echinochloa crus-galli) in Arkansas rice. Weed Technol, 21(2): 324-331.
[31]	van Eerd L L, Stephenson G R, Kwiatkowski J, Grossmann K, Hall J C.2005. Physiological and biochemical characterization of quinclorac resistance in a false cleavers (Galium spurium L.) biotype. J Agric Food Chem, 53(4): 1144-1151.
[32]	Walsh T A, Neal R, Merlo A O, Honma M, Hicks G R, Wolff K, Matsumura W, Davies J P.2006. Mutations in an auxin receptor homolog AFB5 and in SGT1b confer resistance to synthetic picolinate auxins and not to 2,4-dichlorophenoxyacetic acid or indole-3-acetic acid inArabidopsis. Plant Physiol, 142(2): 542-552.
[33]	Wright A A, Rodriguez-Carres M, Sasidharan R, Koski L, Peterson D G, Nandula V K, Ray J D, Bond J A, Shaw D R.2018. Multiple herbicide-resistant junglerice (Echinochloa colona): Identification of genes potentially involved in resistance through differential gene expression analysis. Weed Sci, 66(3): 1-8.
[34]	Xu J Y, Lv B, Wang Q, Li J, Dong L Y.2013. A resistance mechanism dependent upon the inhibition of ethylene biosynthesis.Pest Manag Sci, 69(12): 1407-1414.
[35]	Yang X, Yu X Y, Li Y F.2013. De novo assembly and characterization of the barnyardgrass(Echinochloa crus-galli) transcriptome using next-generation pyrosequencing. PLoS One, 8(7): e69168.
[36]	Yang X, Zhang Z C, Gu T, Dong M C, Peng Q, Bai L Y, Li Y F.2017. Quantitative proteomics reveals ecological fitness cost of multi-herbicide resistant barnyardgrass (Echinochloa crus-galli L.). J Proteom, 150: 160-169.
[37]	Yasuor H, Milan M, Eckert J W, Fischer A J.2012. Quinclorac resistance: A concerted hormonal and enzymatic effort inEchinochloa phyllopogon. Pest Manag Sci, 68(1): 108-115.
[38]	Zhu J W, Wang J, DiTommaso A, Zhang C X, Zheng G P, Liang W, Islam F, Yang C, Chen X X, Zhou W J.2018. Weed research status, challenges, and opportunities in China. Crop Prot, doi.org/10.1016/j.cropro.2018.02.001.

Primer	Direction	Sequence (5′→3′)
Tubulin	Forward	GTACCTTGAACTATTCGACTTTGC
	Reverse	GGCGTACATCAGGTCGAACTT
EcActin	Forward	CACACTGGTGTCATGGTAGG
	Reverse	AGAAAGTGTGATGCCAGAT
EcCAS	Forward	GAACAAGGTCACAGAGGGATG
	Reverse	CCCTTGTTTTCAGCATCTTCC
EcACS	Forward	AACTGTCGCTTGACCTGATC
	Reverse	CCATCGCCTTTCTGAACTCC
EcACO1	Forward	CTGACCAAGGACCACTACAAG
	Reverse	TCTCCCAGTCCAGGTTCTC
EcACO2	Forward	GTGATCGACTTCTCCAAGCTC
	Reverse	AAGCTGAAAGAATCCCCACTC

Primer	Direction	Sequence (5′→3′)
Tubulin	Forward	GTACCTTGAACTATTCGACTTTGC
	Reverse	GGCGTACATCAGGTCGAACTT
EcActin	Forward	CACACTGGTGTCATGGTAGG
	Reverse	AGAAAGTGTGATGCCAGAT
EcCAS	Forward	GAACAAGGTCACAGAGGGATG
	Reverse	CCCTTGTTTTCAGCATCTTCC
EcACS	Forward	AACTGTCGCTTGACCTGATC
	Reverse	CCATCGCCTTTCTGAACTCC
EcACO1	Forward	CTGACCAAGGACCACTACAAG
	Reverse	TCTCCCAGTCCAGGTTCTC
EcACO2	Forward	GTGATCGACTTCTCCAAGCTC
	Reverse	AAGCTGAAAGAATCCCCACTC

Herbicide	Mode of action	Dose	Survival rate (%)
Herbicide	Mode of action	(g/hm²)	S	R-DC	R-CH
Penoxsulam	ALS inhibitor	30	0	0	0
Bispyribac-sodium	ALS inhibitor	30	0	0	0
Pyrazosulfuron-ethyl	ALS inhibitor	120	5	52 ± 11	75 ± 10
Imazamox	ALS inhibitor	35	0	0	0
Cyhalofop-butyl	ACCase inhibitor	125	0	0	0

Herbicide	Mode of action	Dose	Survival rate (%)
Herbicide	Mode of action	(g/hm²)	S	R-DC	R-CH
Penoxsulam	ALS inhibitor	30	0	0	0
Bispyribac-sodium	ALS inhibitor	30	0	0	0
Pyrazosulfuron-ethyl	ALS inhibitor	120	5	52 ± 11	75 ± 10
Imazamox	ALS inhibitor	35	0	0	0
Cyhalofop-butyl	ACCase inhibitor	125	0	0	0

Time point (h)	Population	Foliar uptake	Translocation (%)
Time point (h)	Population	(%)	Root	Stem and new growth	Treated leaf
6	S	96.5 ± 0.6	2.6 ± 0.4 b	50.5 ± 1.3 a	47.0 ± 1.3 b
	R-DC	97.6 ± 0.0	2.8 ± 0.8 b	43.8 ± 1.6 b	53.4 ± 1.6 a
	R-CH	97.1 ± 0.3	5.8 ± 0.9 a	51.4 ± 1.6 a	42.8 ± 1.2 b
24	S	97.1 ± 0.0	4.2 ± 0.7 b	54.3 ± 2.7 b	41.5 ± 3.2 a
	R-DC	97.0 ± 0.2	4.1 ± 1.4 b	74.1 ± 2.1 a	21.9 ± 1.3 b
	R-CH	96.9 ± 0.2	8.8 ± 0.9 a	71.4 ± 0.9 a	19.8 ± 0.7 b
48	S	96.2 ± 0.6	3.0 ± 0.8 a	73.5 ± 2.2 b	23.6 ± 2.7 a
	R-DC	96.5 ± 0.1	2.3 ± 0.5 a	79.0 ± 1.3 a	18.8 ± 0.9 ab
	R-CH	96.4 ± 0.3	2.2 ± 0.3 a	81.0 ± 0.7 a	16.8 ± 0.6 b