Introgression of Two Drought QTLs into FUNAABOR-2 Early Generation Backcross Progenies Under Drought Stress at Reproductive Stage

doi:10.1016/j.rsci.2018.04.006

Abstract

Abstract:

FUNAABOR-2 is a popular Ofada rice variety grown in a large area under rainfed upland condition across western states of Nigeria. We used the combination of phenotypic and marker-assisted selection (MAS) to improve grain yield of FUNAABOR-2 under drought stress (DS) at the reproductive stage via introgression of two drought quantitative trait loci (QTLs), qDTY12.1 and qDTY2.3. Foreground selection was carried out using peak markers RM511 and RM250, associated with qDTY12.1 and qDTY2.3, respectively, followed by recombinant selection with RM28099 and RM1261 distally flanking qDTY12.1. Furthermore, BC₁F₂-derived introgressed lines and their parents were evaluated under DS and non-stress (NS) conditions during the 2015-2016 dry season. Overall reduction of grain yield under DS compared to NS was recorded. Introgressed lines with qDTY12.1 and qDTY2.3 combinations showed higher yield potential compared to lines with single or no QTL under DS, indicating significant positive interactions between the two QTLs under the FUNAABOR-2 genetic background. Pyramiding of qDTY12.1 and qDTY2.3 in the FUNAABOR-2 genetic background led to higher grain yield production under DS and NS.

Key words: drought, foreground selection, introgressed line, peak marker, yield potential, rice, quantitative trait locus

Okechukwu Anyaoha Christian, Fofana Mamadou, Gracen Vernon, Tongoona Pangirayi, Mande Semon. Introgression of Two Drought QTLs into FUNAABOR-2 Early Generation Backcross Progenies Under Drought Stress at Reproductive Stage[J]. Rice Science, 2019, 26(1): 32-41.

Figures/Tables 6

References 30

[1]	Anyaoha C, Fofana, M, Gracen V, Tongoona P, Blay E, Semon M, Popoola B.2018. Yield potential of upland rice varieties under reproductive-stage drought and optimal water regimes in Nigeria.Plant Genet Res: Charact Util, 16(4): 378-385.
[2]	Atlin G N, Cooper M, Bjørnstad A.2006. A comparison of formal and participatory breeding approaches using selection theory.Euphytica, 122(3): 463-475.
[3]	Badu-Apraku B, Menkir A, Ajala S O, Akinwale R O, Oyekunle M, Obeng-Antwi K.2010. Performance of tropical early-maturing maize cultivars in multiple stress environments.Can J Plant Sci, 90(6): 831-852.
[4]	Bernier J, Kumar A, Ramaiah V, Spaner D, Atlin G.2007. A large-effect QTL for grain yield under reproductive-stage drought stress in upland rice.Crop Sci, 47(2): 507-516.
[5]	Bernier J, Atlin G N, Serraj R, Kumar A, Spaner D.2008. Breeding upland rice for drought resistance.J Sci Food Agr, 88(6): 927-939.
[6]	Collard B C Y, Jahufer M Z Z, Brouwer J B, Pang E C K.2005. An introduction to markers, quantitative trait loci (QTL) mapping and marker-assisted selection for crop improvement: The basic concepts.Euphytica, 142: 169-196.
[7]	Collard B C Y, Mackill D J.2008. Marker-assisted selection: An approach for precision plant breeding in the twenty-first century.Philos T Roy Soc B, 363: 557-572.
[8]	Dalton T J.2004. A household hedonic model of rice traits: Economic values from farmers in West Africa.Agric Econ, 31: 149-159.
[9]	Dixit S, Swamy B P M, Vikram P, Ahmed H U, Sta Cruz M T, Amante M, Atri D, Leung H, Kumar A.2012. Fine mapping of QTLs for rice grain yield under drought reveals sub-QTLs conferring a response to variable drought severities.Theor Appl Genet, 125: 155-169.
[10]	Dixit S, Singh A, Kumar A.2014. Rice breeding for high grain yield under drought: A strategic solution to a complex problem.Int J Agron, 2014: 1-15.
[11]	Ghimire K H, Quiatchon L A, Vikram P, Swamy B P M, Dixit S, Ahmed H, Hemandez J E, Borromeo T H, Kumar A.2012. Identification and mapping of a QTL (qDTY1.1) with a consistent effect on grain yield under drought. Field Crops Res, 131: 88-96.
[12]	Hospital F, Charcosset A.1997. Marker-assisted introgression of quantitative trait loci.Genetics, 147(3): 1469-1485.
[13]	Imolehin E D.1991. Rice improvement and production in Nigeria. WARDA Upland Breeding Task Force Workshop, Bouake.
[14]	Kumar A, Bernier J, Verulkar S, Lafitte H R, Atlin G N.2008. Breeding for drought tolerance: Direct selection for yield, response to selection and use of drought-tolerant donors in upland and lowland-adapted populations.Field Crops Res, 107(3): 221-231.
[15]	Kumar A, Dixit S, Ram T, Yadaw R B, Mishra K K, Mandal N P.2014. Breeding high-yielding drought-tolerant rice: Genetic variations and conventional and molecular approaches.J Exp Bot, 65(21): 6265-6278.
[16]	Lafitte R2003. Managing water for controlled drought in breeding plots. In: Fischer K S, Lafitte R, Fukai S, Atlin G, Hardy B. Breeding Rice for Drought-Prone Environments. Los Banos, the Philippines: International Rice Research Institute: 23-26.
[17]	Lafitte H R, Price A H, Courtois B.2004. Yield response to water deficit in an upland rice mapping population: Associations among traits and genetic markers.Theor Appl Genet, 109(6): 1237-1246.
[18]	Mishra K K, Vikram P, Yadaw R B, Swamy B P M, Dixit S, Sta Cruz M T G, Marker S, Kumar A.2013. qDTY12.1: A locus with a consistent effect on grain yield under drought in rice. BMC Genet, 14: 12.
[19]	Neeraja C N, Maghirang-Rodriguez R, Pamplona A, Heuer S, Collard B C Y, Septiningsih E M, Vergara G, Sanchez D, Xu K, Ismail A M, Mackill D J.2007. A marker-assisted backcross approach for developing submergence-tolerant rice cultivars.Theor Appl Genet, 115(6): 767-776.
[20]	Ologbon O A C, Ikheloa E E, Akerele E O.2012. Adoption of ‘Ofada’ rice variety and technical efficiency of rice-based production systems in Ogun State, Nigeria.World J Agric Sci, 8(6): 624-631.
[21]	Palanog A D, Swamy B P M, Shamsudin N A A, Dixit S, Hernandez J E, Boromeo T H, Sta Cruz P C, Kumar A.2014. Grain yield QTLs with consistent-effect under reproductive- stage drought stress in rice.Field Crops Res, 161: 46-54.
[22]	Saka J O, Lawal B O.2009. Determinants of adoption and productivity of improved rice varieties in southwestern Nigeria.Afr J Biotechnol, 8(19): 4923-4932.
[23]	Shamsudin N A A, Swamy B P M, Ratnam W, Sta Cruz M T, Raman A, Kumar A.2016. Marker assisted pyramiding of drought yield QTLs into a popular Malaysian rice cultivar, MR219.BMC Genet, 17(1): 30.
[24]	Showemimo F A, Gregorio G, Olowe V I O, Ukwungwu M N, Maji A, Adigbo S O, Olaoye O J, Akintokun P O, Bodunde J G, Idowu O T H, Awe C A.2011. Varietal release: Release of two dual purpose ofada rice varieties (Funaabor-1 and Funaabor-2) by federal university of agriculture, abeokuta (Funaab). J Agric Sci Environ, 11(2): 122-123.
[25]	Sreewongchai T, Toojinda T, Thanintorn N, Kosawang C, Vanavichit A, Tharreau D, Sirithunya P.2010. Development of elite indica rice lines with wide spectrum of resistance to Thai blast isolates by pyramiding multiple resistance QTLs. Plant Breeding, 129(2): 176-180.
[26]	Swamy B P M, Kumar A.2011. Sustainable rice yield in watershort drought-prone environments: Conventional and molecular approaches. In: Lee T S. Irrigation Systems and Practices in Challenging Environments. Rijeka, Croatia: InTech: 149-168.
[27]	Swamy B P M, Kumar A.2012. Sustainable rice yield in water-short drought-prone environments: Conventional and molecular approaches. INTECH Open Access Publisher.
[28]	Swamy B P M, Kumar A.2013. Genomics-based precision breeding approaches to improve drought tolerance in rice.Biotechnol Adv, 31(8): 1308-1318.
[29]	Venuprasad R, Lafitte, H R, Atlin G N.2007. Response to direct selection for grain yield under drought stress in rice.Crop Sci, 47(1): 285-293.
[30]	Vikram P, Swamy B P M, Dixit S, Singh R, Singh B P, Miro B, Kohli A, Henry A, Singh N K, Kumar A.2015. Drought susceptibility of modern rice varieties: An effect of linkage of drought tolerance with undesirable traits.Sci Rep, 5: 14799.

QTL	Marker	Chr	Forward sequence (5′-3′)	Reverse sequence (5′-3′)	RT	AT (ºC)
qDTY12.1	RM511	12	CTTCGATCCGGTGACGAC	AACGAAAGCGAAGCTGTCTC	(GAC)7	55
	RM28099	12	TGTGCGGATGCGGGTAAGTCC	CCACCTGTCAACCACCGAAACC	(GAG)7	55
	RM1261	12	GTCCATGCCCAAGACACAAC	GTTACATCATGGGTGACCCC	(AG)16	50
	RM28130	12	CAGCAGACGTTCCGGTTCTACTCG	AGGACGGTGGTGGTGATCTGG	(GAG)7	50
	RM28166	12	TGCTTGCAAACATTGCTTCTGG	ACTGATGTACTGAACACGGGAAGG	(CT)12	50
qDTY2.3	RM250	2	GGTTCAAACCAAGCTGATCA	GATGAAGGCCTTCCACGCAG	(CT)17	55

QTL	Marker	Chr	Forward sequence (5′-3′)	Reverse sequence (5′-3′)	RT	AT (ºC)
qDTY12.1	RM511	12	CTTCGATCCGGTGACGAC	AACGAAAGCGAAGCTGTCTC	(GAC)7	55
	RM28099	12	TGTGCGGATGCGGGTAAGTCC	CCACCTGTCAACCACCGAAACC	(GAG)7	55
	RM1261	12	GTCCATGCCCAAGACACAAC	GTTACATCATGGGTGACCCC	(AG)16	50
	RM28130	12	CAGCAGACGTTCCGGTTCTACTCG	AGGACGGTGGTGGTGATCTGG	(GAG)7	50
	RM28166	12	TGCTTGCAAACATTGCTTCTGG	ACTGATGTACTGAACACGGGAAGG	(CT)12	50
qDTY2.3	RM250	2	GGTTCAAACCAAGCTGATCA	GATGAAGGCCTTCCACGCAG	(CT)17	55

Trait	Parameter	Drought stress	Non-stress
GY (g/m²)	FUNAABOR-2	11.16	262.33
	IR84984-83-15-481-B	56.43	359.3
	Population mean	29.89	192.37
	Highest line	86.67	586.36
	Lowest line	0	29.54
	SED	9.03	46.6
	LSD	17.87	92.2
	Heritability (%)	91	83
	P-value	1.98 × 10^-31	4.25 × 10^-18
DAF (d)	FUNAABOR-2	77.46	71.67
	IR84984-83-15-481-B	61.83	58
	Population mean	70.92	65.07
	Highest line	89	78
	Lowest line	57	53
	SED	4.49	2.71
	LSD	8.87	5.36
	Heritability (%)	70	79
	P-value	2.08 × 10^-9	1.34 × 10^-14
PH (cm)	FUNAABOR-2	122.11	139.33
	IR84984-83-15-481-B	121.43	126.44
	Population mean	118.55	137.28
	Highest line	149.33	163.33
	Lowest line	84.33	113.33
	SED	9.89	5.33
	LSD	19.57	10.56
	Heritability (%)	58	82
	P-value	1.43 × 10^-5	4.61 × 10^-17

Trait	Parameter	Drought stress	Non-stress
GY (g/m²)	FUNAABOR-2	11.16	262.33
	IR84984-83-15-481-B	56.43	359.3
	Population mean	29.89	192.37
	Highest line	86.67	586.36
	Lowest line	0	29.54
	SED	9.03	46.6
	LSD	17.87	92.2
	Heritability (%)	91	83
	P-value	1.98 × 10^-31	4.25 × 10^-18
DAF (d)	FUNAABOR-2	77.46	71.67
	IR84984-83-15-481-B	61.83	58
	Population mean	70.92	65.07
	Highest line	89	78
	Lowest line	57	53
	SED	4.49	2.71
	LSD	8.87	5.36
	Heritability (%)	70	79
	P-value	2.08 × 10^-9	1.34 × 10^-14
PH (cm)	FUNAABOR-2	122.11	139.33
	IR84984-83-15-481-B	121.43	126.44
	Population mean	118.55	137.28
	Highest line	149.33	163.33
	Lowest line	84.33	113.33
	SED	9.89	5.33
	LSD	19.57	10.56
	Heritability (%)	58	82
	P-value	1.43 × 10^-5	4.61 × 10^-17

Under non-stress condition					Backcross line	Under drought stress condition
GY	DAF	PH	qDTY12.1	qDTY2.3		GY	DAF	PH	qDTY12.1	qDTY2.3
(g/m²)	(d)	(cm)	qDTY12.1	qDTY2.3		(g/m²)	(d)	(cm)	qDTY12.1	qDTY2.3
417.73	66.33	136	N	N	BC91-1	79.38	70.65	138.44	Y	Y
398.48	67.33	130	Y	Y	BC50	76.12	73.02	110	N	N
345.45	67	132.56	N	N	BC69	74.11	76.98	110.11	Y	Y
334.94	69.67	141.67	N	N	BC43	72.91	73.49	116.56	N	N
318.18	67.67	141.11	N	N	BC27-1	72.44	74.96	114.11	Y	Y
315.91	66	146	Y	N	BC103	66.18	74.68	122.22	N	N
301.52	72	125.44	Y	N	BC57	55.71	75.29	127.22	Y	N
284.85	68.33	138.89	N	N	BC114	55.33	72.96	124.56	N	N
277.52	60.33	124.67	Y	N	BC81	54.92	66.46	110.22	N	N
275	68.67	153.33	N	N	BC75	54.16	73.52	122.19	N	N
264.09	65	142.33	N	N	BC16	51.51	71.47	118.78	Y	N
254.54	69	128	Y	Y	BC111	51.21	73.63	116.67	N	N
252.27	65.33	131.67	N	N	BC14	47.94	62.79	112.33	N	N
251.09	68	151.33	N	Y	BC59	47.41	75.35	130.11	N	N
250	64.67	143.67	N	N	BC84	45.01	73.77	119.33	Y	N
247.73	69	133.89	N	N	BC74	43.12	69.8	108.67	N	N
246.24	61.33	146.61	Y	Y	BC173	42.96	70	130.44	N	N
244.7	66.67	136.67	Y	N	BC4	42.64	73.14	122.56	N	N
262.3	71.67	139.33	N	N	FUNAABOR-2	11.16	77.46	122.11	N	N
359.3	58	126.44	Y	Y	IR84984-83-15-481-B	56.42	61.83	121.43	Y	Y
46.6	2.71	5.33			SED ^a	9.03	4.49	9.89
92.2	5.36	10.56			LSD ^a	17.87	8.87	19.57