OsSCE1 Encoding SUMO E2-Conjugating Enzyme Involves in Drought Stress Response of Oryza sativa

doi:10.1016/j.rsci.2017.11.002

Abstract

Abstract:

Small ubiquitin-like modifier (SUMO)-conjugating enzymes are involved in post-translational regulatory processes in eukaryotes, including the conjugation of SUMO peptides to protein substrate (SUMOylation). SUMOylation plays an important role in improving plant tolerance to abiotic stress such as salt, drought, heat and cold. Herein, we reported the isolation of OsSCE1 (LOC_Os10g39120) gene encoding a SUMO-conjugating enzyme from rice (Oryza sativa cv. Nipponbare) and its functional validation in response to drought stress. The E2 enzyme, OsSCE1, is one of three key enzymes involved in the conjugation of SUMO to its target proteins. Activated SUMO is transferred to the cysteine of an E2 enzyme and then to the target lysine residue of the substrate, with or without the help of an E3 SUMO ligase. Expression of OsSCE1 was strongly induced by polyethylene glycol 6000 (PEG6000) treatment, which suggested OsSCE1 may be involved in the drought stress response. Overexpression of OsSCE1 (OsSCE1-OX) in Nipponbare reduced the tolerance to drought stress. Conversely, the drought tolerance was slightly improved by the knockdown of OsSCE1 (OsSCE1-KD). These results were further supported by measurement of proline content in OsSCE1-OX and OsSCE1-KD transgenic lines under induced drought stress, which showed OsSCE1-KD transgenic lines accumulated higher proline content than the wild type, whereas OsSCE1-OX line had lower proline content than the wild type. These findings suggested OsSCE1 may play a role as a negative regulator in response to drought stress in rice.

Key words: Oryza sativa, drought stress, small ubiquitin-like modifier, SUMO-conjugating enzyme, proline content, gene expression

Nurdiani Dini, Widyajayantie Dwi, Nugroho Satya. OsSCE1 Encoding SUMO E2-Conjugating Enzyme Involves in Drought Stress Response of Oryza sativa[J]. Rice Science, 2018, 25(2): 73-81.

Figures/Tables 8

Table 1 Primers used in this study.

Function	Primer	Sequence (5′-3′) ^a	Reference
RT-PCR SCE1 primer	SCE1-F	AAAGATCTCATGTCGGGAGGGATCGCACGC (BglII)
	SCE1-R	GCGGTCACCTCAAAGCAAAGCAGGGTACTG (BstEII)
amiRNA primer	I miR-s	agTAAAAATGTGATAACCGTCGGcaggagattcagtttga
	II miR-a	tgCCGACGGTTATCACATTTTTActgctgctgctacagcc
	III miR*s	ctCCGACCGTTTTCACATTTTTAttcctgctgctaggctg
	IV miR*a	aaTAAAAATGTGAAAACGGTCGGagagaggcaaaagtgaa
	G-11491	ccctcagatctCAGCAGCAGCCACAGCAAA (BglII)	Warthmann et al, 2008
	G-11494	ctcggtcaccGCTGCTGATGCTGATGCCAT (BstEII)	Warthmann et al, 2008
Hygromycin^r gene primer	hpt-F	GATGCCTCCGCTCGAAGTAGCG
	hpt-R	GCATCTCCCGCCGTGCAC
qRT-PCR primer	q-SCE1-F	ACCCAAGTGCAAGTTCCCACAG
	q-SCE1-R	GGATAGTGGCTGGAGACCTGCTAT
	q-Actin-F	AAGGCCAATCGTGAGAAGATGACC
	q-Actin-R	CCACAGGTATTGTGTTGGACTCTG

Fig. 1. Multiple sequence alignment (A) and phylogenetic tree analysis (B) of SCE1 protein isolated in this study against reported SCE sequences in database. 1, Oryza sativa XP_015614559.1; 2, O. brachyantha XP_006662001.1; 3, Setaria italica XP_004983815.1; 4, Sorghum bicolor XP_002465018.1; 5, Zea mays XP_008657947.1; 6, Triticum urartu EMS60436.1; 7, Musa acuminata XP_009389843.1; 8, Arabidopsis thaliana NP_191346.1. The colour of alignment indicates conservation among sequences. Dark blue, completely conserved; Pink, ≥ 80% conserved; Cyan, ≥ 50% conserved. Ubiquitin conjugating enzyme-like domains are indicated by the red dashed line. The phylogenetic tree was constructed using the neighbour-joining method (DnaMan1). The numbers at the nodes indicate bootstap values based on 1000 bootstrap replications.

Fig. 2. Expression analysis of OsSCE1 gene. A, Expression pattern of OsSCE1 gene in different tissues of Nipponbare. Data represent Mean ± SD (n = 2). B, Relative expression level of OsSCE1 gene in the leaves of plants treated with PEG6000. Data represent Mean ± SD (n = 3).

Fig. 3. Overexpression and knock-down analysis of OsSCE1 gene. A, Diagram of P35S:SCE1 construct; B, Diagram of P35S:amiSCE1 construct; C, Southern blot analysis of OsSCE1-OX transgenic plants using hygromycin resistance gene as probe; D, Southern blot analysis of OsSCE1-KD transgenic plants using hygromycin resistance gene as probe.

Fig. 4. Relative expression level of OsSCE1 gene in OsSCE1-OX (S15.1 and S54.3) and OsSCE1-KD (AS242.4 and AS250.9) plants under normal conditions. Data represent Mean ± SD (n = 3). WT, Wild type.

Fig. 5. Morphology of positive transgenic rice lines harboring overexpression (S15.1 and S54.3) and knockdown (AS242.4 and AS250.9) of OsSCE1 gene constructs in comparison with wild type (WT).

Fig. 6. Drought stress tolerance of OsSCE1 overexpressed and knockdown plants. OX1, S15.1; OX2, S54.3; WT, Wild type; KD1, AS242.4; KD2, AS250.9. A, Drought stress tolerance assay of the OsSCE1 transgenic and WT plants under 20% PEG6000 treatment; B, Survival rate of transgenic and WT plants after 7 d of drought stress. Values are survival percentage of plants after PEG6000 treatment (n = 14). Different letters above the bars indicate significant difference at the 0.05 level.

Fig. 7. Proline content in the leaves of 3-week-old transgenic and control plants with or without drought treatment. Values are Mean ± SD of three independent experiments.* and ** represent significant differences at the 0.05 and 0.01 levels, respectively.WT, Wild type.

References 29

[1]	Bates L S, Waldren R P, Teare I D.1973. Rapid determination of free proline for water-stress studies.Plant Soil, 39(1): 205-207.
[2]	Castro P H, Tavares R M, Bejarano E R, Azevedo H.2012. SUMO, a heavyweight player in plant abiotic stress responses.Cel Mol Life Sci, 69: 3269-3283.
[3]	Castro P H, Couto D, Freitas S, Verde N, Macho A P, Huguet S, Botella M A, Ruiz-Albert J, Tavares R M, Bejarano E R, Azevedo H.2016. SUMO proteases ULP1c and ULP1d are required for development and osmotic stress responses in Arabidopsis thaliana. Plant Mol Biol, 92(1/2): 143-159.
[4]	Catala R, Ouyang J, Abreu I A, Hu Y, Seo H, Zhang X, Chua N H.2007. The Arabidopsis E3 SUMO ligase SIZ1 regulates plant growth and drought responses. Plant Cell, 19(9): 2952-2966.
[5]	Chaikam V, Karlson D T.2010. Response and transcriptional regulation of rice SUMOylation system during development and stress conditions.BMB Rep, 42: 103-109.
[6]	Feng D F, Doolittle R F.1987. Progressive sequence alignment as a prerequisite to correct phylogenetic trees.J Mol Evol, 25(4): 351-360.
[7]	Hayat S, Hayat Q, Alyemeni M N, Wani A S, Pichtel J, Ahmad A.2012. Role of proline under changing environments: A review.Plant Signal Behav, 7: 1456-1466.
[8]	Hiei Y, Ohta S, Komari T, Kumashiro T.1994. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J, 6(2): 271-282.
[9]	Jiang Y J, Qiu Y P, Hu Y R, Yu D Q.2016. Heterologous expression of AtWRKY57 confers drought tolerance in Oryza sativa. Front Plant Sci, 7: 145.
[10]	Karan R, Subudhi P K.2012. A stress inducible SUMO conjugating enzyme gene (SaSce9) from a grass halophyte Spartina alterniflora enhances salinity and drought stress tolerance in Arabidopsis. BMC Plant Biol, 12(1): 187.
[11]	Kurepa J, Walker J M, Smalle J, Gosink M M, Davis S J, Durham T L, Sung D Y, Vierstra R D.2003. The small ubiquitin-like modiﬁer (SUMO) protein modiﬁcation system in Arabidopsis. J Biol Chem, 278: 6862-6872.
[12]	Lee J, Nam J, Park H C, Na G, Miura K, Jin J B, Yoo C Y, Baek D, Kim D H, Jeong J C, Kim D, Lee S Y, Salt D E, Mengiste T, Gong Q, Ma S, Bohnert H J, Kwak S S, Bressan R A, Hasegawa P M, Yun D J.2006. Salycilic acid-mediated innate immunity in Arabidopsis is regulated by SIZ1 SUMO E3 ligase. Plant J, 49(1): 79-90.
[13]	Livak K J, Schmittgen T D.2001. Analaysis of relative gene expression data using real time quantitative PCR and the 2-∆∆CT method.Methods, 25: 402-408.
[14]	Lois L M, Lima C D, Chua N H.2003. Small ubiquitin-like modiﬁer modulates abscisic acid signaling in Arabidopsis. Plant Cell, 15(6): 1347-1359.
[15]	Miura K, Rus A, Sharkhuu A, Yokoi S, Karthikeyan A S, Raghothama K G, Baek D, Koo Y D, Jin J B, Bressan R A, Yun D J, Hasegawa P M.2005. The Arabidopsis SUMO E3 ligase SIZ1 controls phosphate deﬁciency responses. Proc Natl Acad Sci USA, 102: 7760-7765.
[16]	Miura K, Jin J B, Hasegawa P M.2007a. SUMOylation, a post-translational regulatory process in plants.Curr Opin Plant Biol, 10(5): 495-502.
[17]	Miura K, Jin J B, Lee J, Yoo C Y, Stirm V, Miura T, Ashworth E N, Bressan R A, Yun D J, Hasegawa P M.2007b. SIZ1-mediated SUMOylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance in Arabidopsis. Plant Cell, 19(4): 1403-1414.
[18]	Miura K, Okamoto H, Okuma E, Shiba H, Kamada H, Hasegawa P M, Murata Y.2013. SIZ1 deficiency causes reduced stomatal aperture and enhanced drought tolerance via controlling salycilic acid-induced accumulation of reactive oxygen species in Arabidopsis. Plant J, 73(1): 91-104.
[19]	Nigam N, Singh A, Sahi C, Chandramouli A, Grover A.2008. SUMO-conjugating enzyme (Sce) and FK506-binding protein (FKBP) encoding rice (Oryza sativa L.) genes: Genome-wide analysis, expression studies and evidence for their involvement in abiotic stress response. Mol Genet Genom, 279(4): 371-383.
[20]	Park H J, Kim W Y, Park H C, Lee S Y, Bohnert H J, Yun D J.2011. SUMO and SUMOylation in plants.Mol Cells, 32(4): 305-316.
[21]	Raorane M L, Mutte S K, Varadarajan A R, Pabuayon I M, Kohli A.2013. Protein SUMOylation and plant abiotic stress signaling: In silico study of rice RLKs, heat shock and Ca(2+)-binding proteins. Plant Cell Rep, 32(7): 1053-1065.
[22]	Roberts C S, Rajagopal S, Smith L A, Nguyen T A, Yang W, Nugroho S, Ravi K S, Cao M L, Vijayachandra K, Patell V, Harcourt R L, Dransfield L, Desamero N, Slamet I, Keese P, Killian A, Jefferson R A.1997. A comprehensive set of modular vectors for advanced manipulations and efficient transformation of plants by both Agrobacterium and direct DNA uptake methods. In: Proceedings of Rockefeller Foundation Meeting of the International Program on Rice Biotechnology. 15-20 September. Malacca, Malaysia.
[23]	Thompson J D, Higgins D G, Gibson T J.1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.Nucl Acids Res, 22: 4673-4680.
[24]	Tomanov K, Zeschmann A, Hermkes R, Eifler K, Ziba I, Grieco M, Novatchkova M, Hofmann K, Hesse H, Bachmair A.2014. Arabidopsis PIAL1 and 2 promote SUMO chain formation as E4-type SUMO ligases and are involved in stress responses and sulfur metabolism. Plant Cell, 26(11): 4547-4560.
[25]	Verger A, Perdomo J, Crossley M.2003. Modiﬁcation with SUMO: A role in transcriptional regulation.EMBO Rep, 4(2): 137-142.
[26]	Warthmann N, Chen H, Ossowski S, Weigel D, Hervé P.2008. Highly specific gene silencing by artificial miRNAs in rice.PLoS One, 3(3): e1829.
[27]	Xiong H Y, Li J J, Liu P L, Duan J Z, Zhao Y, Guo X, Li Y, Zhang H L, Ali J, Li Z C.2014. Overexpression of OsMYB48-1, a novel MYB-related transcription factor, enhances drought and salinity tolerance in rice. PLoS One, 9(3): e92913.
[28]	Xiong R Y, Wang A M.2013. SCE1, the SUMO-conjugating enzyme in plants that interacts with NIb, the RNA-dependent RNA polymerase ofTurnip mosaic virus, is required for viral infection. J Virol, 87(8): 4704-4715.
[29]	Zhang S C, Qi Y L, Liu M, Yang C W.2013. SUMO E3 ligase AtMMS21 regulates drought tolerance in Arabidopsis thaliana. J Integr Plant Biol, 55(1): 83-95.
	(Managing Editor: Li Guan)